CAB39L (NM_001287338) Human Untagged Clone

CAT#: SC335438

CAB39L (untagged) - Human calcium binding protein 39-like (CAB39L), transcript variant 3



  "NM_001287338" in other vectors (2)

CNY 3230.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-CAB39L Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA103J18.3; MO2L; MO25-BETA
Vector pCMV6-Entry
Sequence Data
>SC335438 representing NM_001287338.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAAAAAATGCCTTTGTTTAGTAAATCACACAAAAATCCAGCAGAAATTGTGAAAATCCTGAAAGAC
AATTTGGCCATTTTGGAAAAGCAAGACAAAAAGACAGACAAGGCTTCAGAAGAAGTGTCTAAATCACTG
CAAGCAATGAAAGAAATTCTGTGTGGTACAAACGAGAAAGAACCCCCAACAGAAGCAGTGGCTCAGCTA
GCACAAGAACTCTACAGCAGTGGCCTGCTAGTGACACTGATAGCTGACCTGCAGCTGATAGACTTTGAG
GGAAAAAAAGATGTGACCCAGATATTTAACAACATCTTGAGAAGACAGATAGGCACTCGGAGTCCTACT
GTGGAGTATATTAGTGCTCATCCTCATATCCTGTTTATGCTCCTCAAAGGATATGAAGCCCCACAGATT
GCCTTACGTTGTGGGATTATGCTGAGAGAATGTATTCGACATGAACCACTTGCCAAAATCATCCTCTTT
TCTAATCAATTCAGAGATTTCTTTAAGTACGTGGAGTTGTCAACATTTGATATTGCTTCAGATGCCTTT
GCTACTTTCAAGGATTTACTAACCAGACATAAAGTGTTGGTAGCAGACTTCTTAGAACAAAATTACGAC
ACTATTTTTGAAGACTATGAGAAATTGCTTCAGTCTGAGAATTATGTTACTAAGAGACAGTCTTTAAAG
CTGCTAGGGGAGCTGATCCTGGACCGTCACAACTTTGCCATCATGACAAAGTATATCAGCAAGCCGGAG
AACCTGAAACTCATGATGAACCTCCTTCGGGATAAAAGTCCCAACATCCAGTTTGAAGCCTTTCATGTT
TTTAAGGTGTTTGTGGCCAGTCCTCACAAAACACAGCCTATTGTGGAGATCCTGTTAAAAAATCAGCCC
AAACTCATTGAGTTTCTGAGCAGCTTCCAAAAAGAAAGGACGGATGATGAGCAGTTCGCTGACGAGAAG
AACTACTTGATTAAACAGATCCGAGACTTGAAGAAAACGGCCCCTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001287338
Insert Size 1014 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001287338.1
RefSeq Size 3713 bp
RefSeq ORF 1014 bp
Locus ID 81617
UniProt ID Q9H9S4
Protein Pathways mTOR signaling pathway
MW 39.1 kDa
Gene Summary Component of a complex that binds and activates STK11/LKB1. In the complex, required to stabilize the interaction between CAB39/MO25 (CAB39/MO25alpha or CAB39L/MO25beta) and STK11/LKB1 (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains 3 alternate 5' non-coding exons compared to variant 1. Variants 1-5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...