LACTB (NM_001288585) Human Untagged Clone

CAT#: SC335399

LACTB (untagged) - Human lactamase, beta (LACTB), transcript variant 3



  "NM_001288585" in other vectors (2)

CNY 3230.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-LACTB Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms G24; MRPL56
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335399 representing NM_001288585.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTACCGGCTCATGTCAGCAGTGACTGCCCGGGCTGCCGCCCCCGGGGGCTTGGCCTCAAGCTGCGGA
CGACGCGGGGTCCATCAGCGCGCCGGGCTGCCGCCTCTCGGCCACGGCTGGGTCGGGGGCCTCGGGCTG
GGGCTGGGGCTGGCGCTCGGGGTGAAGCTGGCAGGTGGGCTGAGGGGCGCGGCCCCGGCGCAGTCCCCC
GCGGCCCCCGACCCTGAGGCGTCGCCTCTGGCCGAGCCGCCACAGGAGCAGTCCCTCGCCCCGTGGTCT
CCGCAGACCCCGGCGCCGCCCTGCTCCAGGTGCTTCGCCAGAGCCATCGAGAGCAGCCGCGACCTGCTG
CACAGGATCAAGGATGAGGTGGGCGCACCGGGCATAGTGGTTGGAGTTTCTGTAGATGGAAAAGAAGTC
TGGTCAGAAGGTTTAGGTTATGCTGATGTTGAGAACCGTGTACCATGTAAACCAGAGACAGTTATGCGA
ATTGCTAGCATCAGCAAAAGTCTCACCATGGTTGCTCTTGCCAAATTGTGGGAAGCAGGGAAACTGGAT
CTTGATATTCCAGTACAACATTATGTTCCCGAATTCCCAGAAAAAGAATATGAAGGTGAAAAGGTTTCT
GTCACAACAAGATTACTGATTTCCCATTTAAGTGGAATTCGTCATTATGAAAAGGACATAAAAAAGGTG
AAAGAAGAGAAAGCTTATAAAGCCTTGAAGATGATGAAAGAGAATGTTGCATTTGAGCAAGAAAAAGAA
GGCAAAAGTAATGAAAAGAATGATTTTACTAAATTTAAAACAGAGCAGGAGAATGAAGCCAAATGCCGG
AATTCAAAACCTGGCAAGAAAAAGAATGATTTTGAACAAGGCGAATTATATTTGAGAGAAAAGTTTGAA
AATTCAATTGAATCCCTAAGATTATTTAAAAATGATCCTTTGTTCTTCAAACCTGTCAGTTTTTGTATT
CAACTTTTGGCTATACCCTACTGGCAGCCATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001288585
Insert Size 999 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001288585.1
RefSeq Size 3007 bp
RefSeq ORF 999 bp
Locus ID 114294
UniProt ID P83111
Protein Families Protease
MW 36.5 kDa
Gene Summary This gene encodes a mitochondrially-localized protein that has sequence similarity to prokaryotic beta-lactamases. Many of the residues responsible for beta-lactamase activity are not conserved in this protein, suggesting it may have a different enzymatic function. Increased expression of the related mouse gene was found to be associated with obesity. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (3) contains multiple differences in the 3' coding region and 3' UTR, compared to variant 1, one of which results in a frameshift. The encoded isoform (c) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...