EST1A (SMG6) (NM_001282326) Human Untagged Clone

CAT#: SC335386

SMG6 (untagged) - Human SMG6 nonsense mediated mRNA decay factor (SMG6), transcript variant 5



  "NM_001282326" in other vectors (2)

CNY 3230.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SMG6 Antibody - middle region
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C17orf31; EST1A; hSMG5/7a; SMG-6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335386 representing NM_001282326.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGATTTAGGCTTTGCCACCAGAGGGGTTGCTGTCCACATGAGAGAGAGAACACCTGCACCTGTAAA
ATGATCATCAGTAGTCTCCAGGTTATTGCAGCTGACTGCAAAAGGGTCACAGTGCTGAAGTATTTTCTG
GAAGCCCTTTGTGGACAAGAAGAGCCTCTGCTGGCATTCAAGGGTGGAAAGTATGTGTCAGTGGCACCC
GTCCCAGACACCATGGGAAAGGAAATGGGAAGCCAAGAGGGAACACGACTGGAAGATGAGGAGGAGGAT
GTGGTGATTGAAGACTTTGAGGAAGATTCAGAGGCTGAAGGCAGCGGAGGCGAGGATGACATCAGGGAG
CTTCGGGCCAAGAAGCTGGCTCTGGCCAGGAAGATAGCTGAGCAGCAGCGTCGCCAGGAAAAGATCCAG
GCTGTCCTGGAGGACCACAGTCAGATGAGGCAGATGGAGCTCGAAATCAGACCTTTGTTCCTCGTACCA
GACACCAACGGCTTCATTGACCACCTGGCCAGTCTGGCGCGGCTGCTGGAGAGCAGGAAGTACATCCTG
GTGGTGCCCCTCATCGTGATCAATGAGCTGGACGGCCTGGCCAAGGGGCAGGAGACAGACCACCGGGCT
GGGGGCTACGCCCGTGTGGTACAAGAGAAGGCCCGCAAGTCCATCGAGTTCCTCGAGCAGCGATTCGAG
AGTCGGGACTCTTGCCTGCGAGCCCTGACCAGCCGTGGCAATGAACTCGAATCCATCGCCTTCCGCAGT
GAGGACATCACTGGCCAGCTGGGTAACAACGATGATCTCATCCTGTCCTGCTGCCTCCACTACTGCAAA
GACAAGGCTAAGGACTTCATGCCCGCCAGCAAAGAGGAGCCAATCCGGCTACTGCGGGAGGTGGTGCTG
TTGACGGATGACCGGAACCTGCGTGTGAAGGCGCTCACAAGGAATGTTCCTGTACGGGACATCCCAGCC
TTCCTCACGTGGGCCCAGGTGGGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282326
Insert Size 993 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282326.1
RefSeq Size 4243 bp
RefSeq ORF 993 bp
Locus ID 23293
UniProt ID Q86US8
MW 37.5 kDa
Gene Summary This gene encodes a component of the telomerase ribonucleoprotein complex responsible for the replication and maintenance of chromosome ends. The encoded protein also plays a role in the nonsense-mediated mRNA decay (NMD) pathway, providing the endonuclease activity near the premature translation termination codon that is needed to initiate NMD. Alternatively spliced transcript variants encoding distinct protein isoforms have been described. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (5) uses an alternate internal promoter and thus differs in the 5' UTR and 5' coding region compared to variant 1. These differences cause translation initiation at an alternate AUG, and the resulting isoform (4) has a shorter and distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...