SLC25A14 (NM_001282195) Human Untagged Clone

CAT#: SC335347

SLC25A14 (untagged) - Human solute carrier family 25 (mitochondrial carrier, brain), member 14 (SLC25A14), transcript variant 1



  "NM_001282195" in other vectors (2)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-SLC25A14 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BMCP1; UCP5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335347 representing NM_001282195.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGTATCTTTCCCGGAATAATCCTAATTTTTCTAAGGGTGAAGTTTGCAACGGCGGCCGTGATTGTA
AGCGGACACCAGAAAAGTACCACTGTAAGTCATGAGATGTCTGGTCTGAATTGGAAACCCTTTGTATAT
GGCGGCCTTGCCTCTATCGTGGCTGAGTTTGGGACTTTCCCTGTGGACCTTACCAAAACACGACTTCAG
GTTCAAGGCCAAAGCATTGATGCCCGTTTCAAAGAGATAAAATATAGAGGGATGTTCCATGCGCTGTTT
CGCATCTGTAAAGAGGAAGGTGTATTGGCTCTCTATTCAGGAATTGCTCCTGCGTTGCTAAGACAAGCA
TCATATGGCACCATTAAAATTGGGATTTACCAAAGCTTGAAGCGCTTATTCGTAGAACGTTTAGAAGAT
GAAACTCTTTTAATTAATATGATCTGTGGGGTAGTGTCAGGAGTGATATCTTCCACTATAGCCAATCCC
ACCGATGTTCTAAAGATTCGAATGCAGGCTCAAGGAAGCTTGTTCCAAGGGAGCATGATTGGAAGCTTT
ATCGATATATACCAACAAGAAGGCACCAGGGGTCTGTGGAGGGGTGTGGTTCCAACTGCTCAGCGTGCT
GCCATCGTTGTAGGAGTAGAGCTACCAGTCTATGATATTACTAAGAAGCATTTAATATTGTCAGGAATG
ATGGGCGATACAATTTTAACTCACTTCGTTTCCAGCTTTACATGTGGTTTGGCTGGGGCTCTGGCCTCC
AACCCGGTTGATGTGGTTCGAACTCGCATGATGAACCAGAGGGCAATCGTGGGACATGTGGATCTCTAT
AAGGGCACTGTTGATGGTATTTTAAAGATGTGGAAACATGAGGGCTTTTTTGCACTCTATAAAGGATTT
TGGCCAAACTGGCTTCGGCTTGGACCCTGGAACATCATTTTTTTTATTACATACGAGCAGCTAAAGAGG
CTTCAAATCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282195
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282195.1
RefSeq Size 1656 bp
RefSeq ORF 978 bp
Locus ID 9016
UniProt ID O95258
Protein Families Druggable Genome
MW 36.2 kDa
Gene Summary Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). Uncoupling proteins separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. Uncoupling proteins facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. This gene is widely expressed in many tissues with the greatest abundance in brain and testis. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 4. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (1, also known as UCP5L or long) encodes isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...