FMO2 (NM_001301347) Human Untagged Clone

CAT#: SC335285

FMO2 (untagged) - Human flavin containing monooxygenase 2 (non-functional) (FMO2), transcript variant 3



  "NM_001301347" in other vectors (2)

CNY 3040.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


FMO2 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FMO1B1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335285 representing NM_001301347.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCCGTATCTCTGAAGATGGCTATCCTTGGGACTCAGTGTTCCACACCCGGTTTCGTTCTATGCTC
CGCAATGTACTGCCACGAACAGCTGTAAAATGGATGATAGAACAACAGATGAATCGGTGGTTCAACCAT
GAAAATTATGGCCTTGAGCCTCAAAACAAATACATTATGAAGGAACCTGTACTAAATGATGATGTCCCA
AGTCGTCTACTCTGTGGAGCCATCAAGGTGAAATCTACAGTGAAAGAGCTCACAGAAACTTCTGCCATC
TTTGAGGATGGAACAGTGGAGGAGAACATTGATGTCATCATTTTTGCAACAGGATATAGTTTCTCTTTT
CCCTTCCTTGAAGATTCACTCGTTAAAGTAGAGAATAATATGGTCTCACTGTATAAATACATATTCCCC
GCTCACCTGGACAAGTCAACCCTCGCGTGCATTGGTCTCATCCAGCCCCTAGGTTCCATTTTCCCAACT
GCTGAACTTCAAGCTCGTTGGGTGACAAGAGTTTTCAAAGGCTTGTGTAGCCTGCCCTCAGAGAGAACT
ATGATGATGGACATTATCAAAAGGAATGAAAAAAGAATTGACCTGTTTGGAGAAAGCCAGAGCCAGACG
TTGCAGACCAATTATGTTGACTACTTGGACGAGCTCGCCTTAGAGATAGGTGCGAAGCCAGATTTCTGC
TCTCTCTTGTTCAAAGATCCTAAACTGGCTGTGAGACTCTATTTCGGACCCTGCAACTCCTATCAGTAT
CGCCTGGTTGGGCCTGGGCAATGGGAAGGAGCCAGAAATGCCATCTTCACCCAGAAACAAAGAATACTG
AAGCCACTCAAGACTCGGGCCCTGAAGGATTCATCTAATTTCTCAGTTTCTTTTCTGTTGAAAATCCTG
GGCCTTCTTGCTGTTGTTGTGGCCTTTTTTTGCCAACTTCAATGGTCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001301347
Insert Size 948 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301347.1
RefSeq Size 5023 bp
RefSeq ORF 948 bp
Locus ID 2327
Protein Pathways Drug metabolism - cytochrome P450
MW 36.2 kDa
Gene Summary This gene encodes a flavin-containing monooxygenase family member. It is an NADPH-dependent enzyme that catalyzes the N-oxidation of some primary alkylamines through an N-hydroxylamine intermediate. However, some human populations contain an allele (FMO2*2A) with a premature stop codon, resulting in a protein that is C-terminally-truncated, has no catalytic activity, and is likely degraded rapidly. This gene is found in a cluster with other related family members on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (3) lacks two alternate exons, and it thus differs in its 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...