PSG7 (NM_001206650) Human Untagged Clone

CAT#: SC335177

PSG7 (untagged) - Human pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene) (PSG7), transcript variant 2



  "NM_001206650" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PSG7 Antibody - middle region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PSBG-7; PSG1; PSGGA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335177 representing NM_001206650.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGCCCCTCTCAGCCCCTCCCTGCACACAGCATATAACCTGGAAAGGGCTCCTGCTCACAGTGGAG
ACTCCCAAACCCTCCATCTCCAGCAGCAATTTCAACCCCAGGGAGGCCACGGAGGCTGTGATTTTAACC
TGTGATCCTGAGACTCCAGATGCAAGCTACCTGTGGTGGATGAATGGTCAGAGCCTCCCTATGACTCAC
AGCTTGCAGCTGTCTGAAACCAACAGGACCCTCTACCTATTTGGTGTCACAAACTATACTGCAGGACCC
TATGAATGTGAAATACGGAACCCAGTGAGTGCCAGCCGCAGTGACCCAGTCACCCTGAATCTCCTCCCG
AAGCTGCCCAAGCCCTACATCACCATCAATAACTTAAACCCCAGGGAGAATAAGGATGTCTCAACCTTC
ACCTGTGAACCTAAGAGTGAGAACTACACCTACATTTGGTGGCTAAATGGTCAGAGCCTCCCGGTCAGT
CCCAGGGTAAAGCGACGCATTGAAAACAGGATCCTCATTCTACCCAGTGTCACGAGAAATGAAACAGGA
CCCTATCAATGTGAAATACGGGACCGATATGGTGGCATCCGCAGTGACCCAGTCACCCTGAATGTCCTC
TATGGTCCAGACCTCCCCAGAATTTACCCTTCATTCACCTATTACCATTCAGGACAAAACCTCTACTTG
TCCTGCTTTGCGGACTCTAACCCACCGGCACAGTATTCTTGGACAATTAATGGGAAGTTTCAGCTATCA
GGACAAAAGCTTTCTATCCCCCAGATTACTACAAAGCATAGCGGGCTCTATGCTTGCTCTGTTCGTAAC
TCAGCCACTGGCAAGGAAAGCTCCAAATCCGTGACAGTCAGAGTCTCTGACTGGACATTACCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001206650
Insert Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206650.1
RefSeq Size 1680 bp
RefSeq ORF 894 bp
Locus ID 5676
Protein Families Secreted Protein
MW 33.4 kDa
Gene Summary This gene is a member of the pregnancy-specific glycoprotein (PSG) gene family. The PSG genes are a subgroup of the carcinoembryonic antigen (CEA) family of immunoglobulin-like genes, and are found in a gene cluster at 19q13.1-q13.2 telomeric to another cluster of CEA-related genes. The PSG genes are expressed by placental trophoblasts and released into the maternal circulation during pregnancy, and are thought to be essential for maintenance of normal pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...