PAX5 (NM_001280550) Human Untagged Clone

CAT#: SC335157

PAX5 (untagged) - Human paired box 5 (PAX5), transcript variant 5



  "NM_001280550" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PAX5 mouse monoclonal antibody, clone OTI3A7 (formerly 3A7)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALL3; BSAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335157 representing NM_001280550.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATTTAGAGAAAAATTATCCGACTCCTCGGACCAGCAGGACAGGACATGGAGGAGTGAATCAGCTT
GGGGGGGTTTTTGTGAATGGACGGCCACTCCCGGATGTAGTCCGCCAGAGGATAGTGGAACTTGCTCAT
CAAGGTGTCAGGCCCTGCGACATCTCCAGGCAGCTTCGGGTCAGCCATGGTTGTGTCAGCAAAATTCTT
GGCAGGTATTATGAGACAGGAAGCATCAAGCCTGGGGTAATTGGAGGATCCAAACCAAAGGTCGCCACA
CCCAAAGTGGTGGAAAAAATCGCTGAATATAAACGCCAAAATCCCACCATGTTTGCCTGGGAGATCAGG
GACCGGCTGCTGGCAGAGCGGGTGTGTGACAATGACACCGTGCCTAGCGTCAGTTCCATCAACAGGATC
ATCCGGACAAAAGTACAGCAGCCACCCAACCAACCAGTCCCAGCTTCCAGTCACAGCATAGTGTCCACT
GGCTCCGTGACGCAGGTGTCCTCGGTGAGCACGGATTCGGCCGGCTCGTCGTACTCCATCAGCGGCATC
CTGGGCATCACGTCCCCCAGCGCCGACACCAACAAGCGCAAGAGAGACGAAGGTATTCAGGAGTCTCCG
GTGCCGAACGGCCACTCGCTTCCGGGCAGAGACTTCCTCCGGAAGCAGATGCGGGGAGACTTGTTCACA
CAGCAGCAGCTGGAGGTGCTGGACCGCGTGTTTGAGAGGCAGCACTACTCAGACATCTTCACCACCACA
GAGCCCATCAAGCCCGAGCAGGCTCCCCCTACTATTATAGCGCTGCCGCCCGAGGAGCCGCCCCACCTG
CAGCCGCCACTGCCTATGACCGTCACTGACCCTTGGAGCCAGGCGGGCACCAAACACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001280550
Insert Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001280550.1
RefSeq Size 8590 bp
RefSeq ORF 888 bp
Locus ID 5079
UniProt ID Q02548
Protein Families Transcription Factors
MW 32.5 kDa
Gene Summary This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. Paired box transcription factors are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (5) lacks three consecutive exons in the 3' coding, which results in a frameshift, compared to variant 1. The encoded isoform (5) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...