RIM2 (RIMS2) (NM_001282882) Human Untagged Clone

CAT#: SC335079

RIMS2 (untagged) - Human regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant 4



  "NM_001282882" in other vectors (2)

CNY 2640.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Rim2 Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRSDS; OBOE; RAB3IP3; RIM2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282882, the custom clone sequence may differ by one or more nucleotides


ATGGGCCGGCAGGGCTTGGGGGGTGCCAGCGCTGCGGGGCGCTCCATGCAGCGCTCCCAGAGCCGGAGTA
GCCTGTCTGCCTCCTTCGAGGCACTGGCCGGCTACTTTCCCTGCATGAACTCCCTGGAGGAGGAAGAAGG
AGAAGCAGGAGGTAAAAAACTAAGGAGCACTGTCCAAAGAAGTACAGAAACAGGCCTGGCCGTGGAAATG
AGGAACTGGATGACTCGACAGGCAAGCCGAGAGTCTACAGATGGTAGCATGAACAGCTACAGCTCAGAAG
GAAATCTGATTTTCCCTGGTGTTCGCTTGGCCTCTGATAGCCAGTTCAGTGATTTCCTGGATGGCCTTGG
CCCTGCTCAGCTAGTGGGACGCCAGACTCTGGCAACACCTGCAATGGGTGACATTCAGGTAGGAATGATG
GACAAAAAGGGACAGCTGGAGGTAGAAATCATCCGGGCCCGTGGCCTTGTTGTAAAACCAGGTTCCAAGA
CACTGCCAGCACCGTATGTAAAAGTGTATCTATTAGATAACGGAGTCTGCATAGCCAAAAAGAAAACAAA
AGTGGCAAGAAAAACGCTGGAACCCCTTTACCAGCAGCTATTATCTTTCGAAGAGAGTCCACAAGGAAAA
GTTTTACAGATCATCGTCTGGGGAGATTATGGCCGCATGGATCACAAATCTTTTATGGGAGTGGCCCAGA
TACTTTTAGATGAACTAGAGCTATCCAATATGGTGATCGGATGGTTCAAACTTTTCCCACCTTCCTCCCT
AGTAGATCCAACCTTGGCCCCTCTGACAAGAAGAGCTTCCCAATCATCTCTGGAAAGTTCAACTGGACCT
TCTTACTCTCGTTCATAG


Restriction Sites SgfI-MluI     
ACCN NM_001282882
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282882.1, NP_001269811.1
RefSeq Size 3780 bp
RefSeq ORF 858 bp
Locus ID 9699
UniProt ID Q9UQ26
Gene Summary The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
Transcript Variant: This variant (4) uses an alternate 5' structure compared to variant 1. The encoded isoform (d) is shorter and has a distinct N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...