LAIR1 (NM_001289026) Human Untagged Clone
CAT#: SC335035
LAIR1 (untagged) - Human leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), transcript variant f
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD305; LAIR-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001289026, the custom clone sequence may differ by one or more nucleotides
ATGGAAAGAGAAATGGTGCTCTGCCTGGCCCAGACCATCCACACGCAGGAGGATCTGCCCAGACCCTCCA TCTCGGCTGAGCCAGGCACCGTGATCCCCCTGGGGAGCCATGTGACTTTCGTGTGCCGGGGCCCGGTTGG GGTTCAAACATTCCGCCTGGAGAGGGACAGTAGATCCACATACAATGATACTGAAGATGTGTCTCAAGCT AGTCCATCTGAGTCAGAGGCCAGATTCCGCATTGACTCAGTAAGAGAAGGAAATGCCGGGCTTTATCGCT GCATCTATTATAAGCCCCCTAAATGGTCTGAGCAGAGTGACTACCTGGAGCTGCTGGTGAAAGAAAGCTC TGGAGGCCCGGACTCCCCGGACACAGAGCCCGGCTCCTCAGCTGGACCCACGCAGAGGCCGTCGGACAAC AGTCACAATGAGCATGCACCTGCTTCCCAAGGCCTGAAAGCTGAGCATCTGTATATTCTCATCGGGGTCT CAGTGGTCTTCCTCTTCTGTCTCCTCCTCCTGGTCCTCTTCTGCCTCCATCGCCAGAATCAGATAAAGCA GGGGCCCCCCAGAAGCAAGGACGAGGAGCAGAAGCCACAGCAGAGGCCTGACCTGGCTGTTGATGTTCTA GAGAGGACAGCAGACAAGGCCACAGTCAATGGACTTCCTGAGAAGGACAGAGAGACGGACACCTCGGCCC TGGCTGCAGGGAGTTCCCAGGAGGTGACGTATGCTCAGCTGGACCACTGGGCCCTCACACAGAGGACAGC CCGGGCTGTGTCCCCACAGTCCACAAAGCCCATGGCCGAGTCCATCACGTATGCAGCCGTTGCCAGACAC TGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289026 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001289026.2, NP_001275955.2 |
RefSeq Size | 2766 bp |
RefSeq ORF | 843 bp |
Locus ID | 3903 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (f) differs in the 5' UTR, lacks part of the 5' coding region, and uses an alternate start codon, compared to variant a. The encoded isoform (f) has a shorter and distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...