UGT2B10 (NM_001290091) Human Untagged Clone

CAT#: SC335030

UGT2B10 (untagged) - Human UDP glucuronosyltransferase 2 family, polypeptide B10 (UGT2B10), transcript variant 3



  "NM_001290091" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
UGT2B10 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UDPGT2B10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001290091, the custom clone sequence may differ by one or more nucleotides


ATGAGGAAAGCTGACATATGGCTTATGCGAAACTCCTGGAATTTTAAATTTCCTCATCCATTCTTACCAA
ATGTTGATTTTGTTGGAGGACTCCACTGCAAACCTGCCAAACCCCTACCTAAGGAAATGGAGGAGTTTGT
ACAGAGCTCTGGAGAAAATGGTGTTGTGGTGTTTTCTCTGGGGTCAATGGTCAGTAACATGACAGAAGAA
AGGGCCAACGTAATTGCAACAGCCCTTGCCAAGATCCCACAAAAGGTTCTTTGGAGATTTGATGGGAATA
AACCAGATGCCTTAGGTCTCAATACTCGACTGTACAAGTGGATACCCCAGAATGACCTTCTAGGTCATCC
AAAAACCAGAGCTTTTATAACTCATGGTGGAGCCAATGGCATCTATGAGGCAATCTACCATGGGATCCCT
ATGGTGGGCATTCCATTGTTTTTTGATCAACCTGATAATATTGCTCACATGAAGGCCAAGGGAGCAGCTG
TTAGAGTGGACTTCAACACAATGTCGAGTACAGACCTGCTGAATGCACTGAAGACAGTAATTAATGATCC
TTCATATAAAGAGAATATTATGAAATTATCAAGAATTCAACATGATCAACCAGTGAAGCCCCTGGATCGA
GCAGTCTTCTGGATTGAATTTGTCATGCGCCACAAAGGAGCCAAACATCTTCGAGTTGCAGCCCACAACC
TCACCTGGTTCCAGTACCACTCTTTGGATGTGATTGGGTTCCTGCTGGCTTGTGTGGCAACCGTGCTATT
TATCATCACAAAGTGTTGTCTGTTTTGTTTCTGGAAGTTTGCTAGAAAAGGAAAGAAGGGAAAAAGGGAT
TAG


Restriction Sites SgfI-MluI     
ACCN NM_001290091
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001290091.1, NP_001277020.1
RefSeq Size 2187 bp
RefSeq ORF 843 bp
Locus ID 7365
UniProt ID P36537
Protein Families Transmembrane
Protein Pathways Androgen and estrogen metabolism, Ascorbate and aldarate metabolism, Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Pentose and glucuronate interconversions, Porphyrin and chlorophyll metabolism, Retinol metabolism, Starch and sucrose metabolism
Gene Summary UDPGT is of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...