P15RS (RPRD1A) (NM_001303412) Human Untagged Clone

CAT#: SC334999

RPRD1A (untagged) - Human regulation of nuclear pre-mRNA domain containing 1A (RPRD1A), transcript variant 3



  "NM_001303412" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RPRD1A Antibody - N-terminal region
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HsT3101; P15RS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001303412, the custom clone sequence may differ by one or more nucleotides


ATGAGAAATTCCAATTGGAGATTTTGTCAAACAGGAATTTACTCCAAACCAAACAGGAAGCTTACTTTTC
TCTACCTAGCCAATGATGTCATACAGAACAGCAAGAGGAAGGGGCCAGAGTTTACAAAAGATTTTGCACC
AGTTATAGTGGAGGCTTTTAAGCATGTTTCAAGTGAAACTGATGAAAGTTGTAAGAAGCACCTTGGAAGA
GTGTTATCTATTTGGGAAGAAAGGTCTGTTTATGAAAATGATGTATTAGAACAACTTAAACAAGCTCTGT
ATGGTGATAAGAAGCCTAGGAAGCGAACTTATGAACAGATAAAGGTGGATGAAAATGAAAACTGTTCCTC
TCTGGGATCTCCAAGTGAACCACCACAGACTCTAGATCTCGTTAGAGCATTACAAGATCTGGAAAATGCA
GCCTCAGGTGATGCAGCAGTTCATCAGAGGATAGCTTCTTTACCTGTTGAAGTCCAAGAAGTATCTCTAT
TAGATAAAATAACAGATAAAGAATCTGGAGAAAGGCTTTCCAAAATGGTAGAGGATGCGTGTATGTTGCT
GGCAGATTACAATGGCAGATTGGCGGCAGAAATAGATGATAGAAAGCAACTCACTCGAATGTTAGCAGAT
TTTCTTCGTTGTCAAAAGGAAGCCCTTGCAGAGAAAGAGCATAAATTGGAAGAGTACAAGCGCAAGCTAG
CCAGAGTTTCCCTGGTGCGCAAAGAACTCAGGTCCCGGATCCAGAGCCTGCCAGACTTATCTCGATTGCC
CAATGTCACTGGCAGCCACATGCACCTGCCCTTTGCGGGAGACATCTACAGTGAAGATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001303412
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001303412.1, NP_001290341.1
RefSeq Size 2028 bp
RefSeq ORF 831 bp
Locus ID 55197
UniProt ID Q96P16
Gene Summary This gene encodes a cell-cycle and transcription regulatory protein. The encoded protein interacts with the cell cycle inhibitor cyclin-dependent kinase 4 inhibitor B and may function as a negative regulator of G(1)/S phase progression. This protein also forms homo- and hetrodimers with the protein, regulation of nuclear pre-mRNA domain-containing protein 1B, to form a scaffold that interacts with the C-terminal domain of RNA polymerase II subunit B1 and regulates several aspects of transcription. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 16. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (3) uses an alternate exon in the 5' UTR and 5' coding region uses an alternate splice site in the 3' UTR. These differences result in the use of an alternate start codon compared to variant 1. The encoded isoform (2) is shorter and has a distinct N_terminus compared to isoform 1. Variant 2 and 3 encode the same isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...