Uroplakin Ia (UPK1A) (NM_001281443) Human Untagged Clone

CAT#: SC334974

UPK1A (untagged) - Human uroplakin 1A (UPK1A), transcript variant 2



  "NM_001281443" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
UPK1A Antibody - middle region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms TSPAN21; UP1A; UPIA; UPKA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001281443, the custom clone sequence may differ by one or more nucleotides


ATGGCGTCTGCGGCAGCAGCGGAGGCCGAGAAGGGATCTCCAGTTGTGGTGGGCCTGCTAGTTGTGGGCA
ATATCATTATTCTGCTGTCAGGCCTGTCCCTGTTTGCTGAGACCATATGGGTGACAGCCGACCAGTACCG
TGTATACCCACTGATGGGAGTCTCAGGCAAGGATGACGTCTTCGCTGGTGCCTGGATTGCCATCTTCTGC
GGCTTCTCCTTCTTCATGGTAGCCAGTTTTGGTGTGGGTGCCGCACTCTGCCGCCGCCGGTCCATGGTCC
TCACGTACCTGGTGCTCATGCTCATCGTCTACATCTTCGAGTGCGCCTCCTGCATCACGTCCTACACCCA
CCGTGACTACATGGTGTCCAACCCATCCCTGATCACCAAGCAGATGCTGACCTTCTACAGCGCGGACACC
GACCAGGGCCAGGAGCTGACCCGCCTCTGGGACCGCGTCATGATTGAGCAAGAATGCTGTGGCACATCTG
GTCCCATGGACTGGGTGAACTTCACGTCAGCCTTCCGGGCGGCCACTCCGGAGGTGGTGTTCCCCTGGCC
CCCACTGTGCTGTCGCCGGACGGGAAACTTCATCCCCCTCAACGAGGAGGGCTGCCGCCTGGGGCACATG
GACTACCTGTTCACCAAGGCTGGAGTACAGTGGCACAATCTCAGCTCACTGCAGCGTCTGCCTCCCGGGT
TCAAGGGATTCTCCCACCTCAGCTTCCAGAGCAGCTGGGATTACAGGGCTGCTTCGAACACATCGGCCAC
GCCATCGACAGCTACACGTGGGGTATCTCGTGGTTTGGGTTTGCCATCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001281443
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001281443.1, NP_001268372.1
RefSeq Size 1382 bp
RefSeq ORF 822 bp
Locus ID 11045
UniProt ID O00322
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is found in the asymmetrical unit membrane (AUM) where it can complex with other transmembrane 4 superfamily proteins. It may play a role in normal bladder epithelial physiology, possibly in regulating membrane permeability of superficial umbrella cells or in stabilizing the apical membrane through AUM/cytoskeletal interactions. The protein may also play a role in tumor suppression. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) contains an alternate exon in the 3' coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) is longer and has a distinct C-terminus, compared to isoform 1.`.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...