ANXA8L1 (NM_001278923) Human Untagged Clone

CAT#: SC334955

ANXA8L1 (untagged) - Human annexin A8-like 1 (ANXA8L1), transcript variant 3



  "NM_001278923" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-ANXA8L2 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ANXA8; ANXA8L2; bA145E20.2; VAC-beta
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278923, the custom clone sequence may differ by one or more nucleotides


ATGGCCTGGTGGAAAGCCTGGATTGAACAGGAGGGTGTCACAGTGAAGAGCAGCTCCCACTTCAACCCAG
ACCCTGATGCAGAGACCCTCTACAAAGCCATGAAGGGGATCGGGACCAACGAGCAGGCTATCATCGATGT
GCTCACCAAGAGAAGCAACACGCAGCGGCAGCAGATCGCCAAGTCCTTCAAGGCTCAGTTCGGCAAGGAC
CTCACTGAGACCTTGAAGTCTGAGCTCAGTGGCAAGTTTGAGAGGCTCATTGTGGCCCTTATGTATCCGC
CATACAGATACGAAGCCAAGGAGCTGCATGACGCCATGAAGGGCAGCAGGGATGATGTGAGCAGCTTTGT
GGACCCGGCACTGGCCCTCCAAGACGCACAGGATCTGTATGCGGCAGGCGAGAAGATTCGTGGGACTGAT
GAGATGAAATTCATCACCATCCTGTGCACGCGCAGTGCCACTCACCTGCTGAGAGTGTTTGAAGAGTATG
AGAAAATTGCCAACAAGAGCATTGAGGACAGCATCAAGAGTGAGACCCATGGCTCACTGGAGGAGGCCAT
GCTCACTGTGGTGAAATGCACCCAAAACCTCCACAGCTACTTTGCAGAGAGACTCTACTATGCCATGAAG
GGAGCAGGGACGCGTGATGGGACCCTGATAAGAAACATCGTTTCAAGGAGCGAGATTGACTTAAATCTTA
TCAAATGTCACTTCAAGAAGATGTACGGCAAGACCCTCAGCAGCATGATCATGGAAGACACCAGCGGCGA
CTACAAGAACGCCCTGCTGAGCCTGGTGGGCAGCGACCCCTGA


Restriction Sites SgfI-RsrII     
ACCN NM_001278923
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278923.1, NP_001265852.1
RefSeq Size 1929 bp
RefSeq ORF 813 bp
Locus ID 728113
Gene Summary This gene encodes a member of the annexin family of evolutionarily conserved Ca2+ and phospholipid binding proteins. The encoded protein may function as an an anticoagulant that indirectly inhibits the thromboplastin-specific complex. Overexpression of this gene has been associated with acute myelocytic leukemia. A highly similar duplicated copy of this gene is found in close proximity on the long arm of chromosome 10. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (3) lacks two alternate exons in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...