Cyclin H (CCNH) (NM_001199189) Human Untagged Clone

CAT#: SC334952

CCNH (untagged) - Human cyclin H (CCNH), transcript variant 2



  "NM_001199189" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal Cyclin H (Ab-315) antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAK; CycH; p34; p37
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001199189, the custom clone sequence may differ by one or more nucleotides


ATGACACTCTGCAAATACTATGAGAAAAGGTTATTGGAATTCTGTTCGGTGTTTAAGCCAGCAATGCCAA
GATCTGTTGTGGGTACGGCTTGTATGTATTTCAAACGTTTTTATCTTAATAACTCAGTAATGGAATATCA
CCCCAGGATAATAATGCTCACTTGTGCATTTTTGGCCTGCAAAGTAGATGAATTCAATGTATCTAGTCCT
CAGTTTGTTGGAAACCTCCGGGAGAGTCCTCTTGGACAGGAGAAGGCACTTGAACAGATACTGGAATATG
AACTACTTCTTATACAGCAACTTAATTTCCACCTTATTGTCCACAATCCTTACAGACCATTTGAGGGCTT
CCTCATCGACTTAAAGACCCGCTATCCCATATTGGAGAATCCAGAGATTTTGAGGAAAACAGCTGATGAC
TTTCTTAATAGAATTGCATTGACGGATGCTTACCTTTTATACACACCTTCCCAAATTGCCCTGACTGCCA
TTTTATCTAGTGCCTCCAGGGCTGGAATTACTATGGAAAGTTATTTATCAGAGAGTCTGATGCTGAAAGA
GAACAGAACTTGCCTGTCACAGTTACTAGATATAATGAAAAGCATGAGAAACTTAGTAAAGAAGTATGAA
CCACCCAGATCTGAAGAAGTTGCTGTTCTGAAACAGAAGTTGGAGCGATGTCATTCTGCTGAGCTTGCAC
TTAACGTAATCACGAAGAAGAGGAAAGGCTATGAAGATGATGATTACGTCTCAAAGAAATCCAAACATGA
GGAGGAAGAATGGACTGATGACGACCTGGTAGAATCTCTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001199189
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199189.1, NP_001186118.1
RefSeq Size 1517 bp
RefSeq ORF 813 bp
Locus ID 902
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Cell cycle, Nucleotide excision repair
Gene Summary The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with CDK7 kinase and ring finger protein MAT1. The kinase complex is able to phosphorylate CDK2 and CDC2 kinases, thus functions as a CDK-activating kinase (CAK). This cyclin and its kinase partner are components of TFIIH, as well as RNA polymerase II protein complexes. They participate in two different transcriptional regulation processes, suggesting an important link between basal transcription control and the cell cycle machinery. A pseudogene of this gene is found on chromosome 4. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Nov 2010]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence and the 3' UTR and coding sequence, and initiates translation at a downstream start codon, compared to variant 3. The encoded isoform (2) is shorter at the N-terminus and has a shorter and distinct C-terminus compared to isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...