BCL2L12 (NM_001282519) Human Untagged Clone
CAT#: SC334951
BCL2L12 (untagged) - Human BCL2-like 12 (proline rich) (BCL2L12), transcript variant 8
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Rabbit polyclonal antibody to Bcl-2-like protein 12 (BCL2-like 12 (proline rich))
CNY 6281.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282519, the custom clone sequence may differ by one or more nucleotides
ATGGGACGGCCCGCTGGGCTGTTCCCGCCCCTATGCCCTTTTTTGGGTTTCCGGCCAGAGGCATGCTGGG AGCGTCACATGCAAATTGAGCGTGCACCCAGCGTTCCGCCCTTTCTACGCTGGGCCGGTTATCGACCCGG CCCAGTGCGCAGGCGCGGGAAAGTTGAACTAATAAAGTTTGTACGAGTTCAGTGGAGGAGACCGCAAGTT GAGTGGAGGAGGCGGCGGTGGGGCCCCGGACCAGGTGCCTCCATGGCAGGCTCTGAAGAGCTGGGGCTCC GGGAAGACACGCTGAGGGTCCTAGCTGCCTTCCTTAGGCGTGGTGAGGCTGCCGGGTCTCCTGTTCCAAC TCCACCTAGAAGCCCTGCCCAAGAAGAGCCAACAGACTTCCTGAGCCGCCTTCGAAGATGTCTTCCCTGC TCCCTGGGGCGAGGAGCAGCCCCCTCTGAGTCCCCTCGGCCTTGCTCTCTGCCCATCCGCCCCTGCTATG GTTTAGAGCCTGGCCCAGCTACTCCAGACTTCTATGCTTTGGTGGCCCAGCGGCTGGAACAGCTGGTCCA AGAGCAGCTGAAATCTCCGCCCAGCCCAGAATTACAGGGTCCCCCATCGACAGAGAAGGAAGCCATACTG CGGAGGCTGGTGGCCCTGCTGGAGGAGGAGGCAGAAGTCATTAACCAGAAGGTGATGGGCATCTGTCCCA CTCCTTGGCAAGGACAGGAGTTGCGGAATGGAGGGCATCCTGGCTGTTTCACCCGTGGACTTGAACTTGC CATTGGACTGAGCTCTTTCTCAGAAGCTGCTACAAGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282519 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282519.1, NP_001269448.1 |
RefSeq Size | 1669 bp |
RefSeq ORF | 810 bp |
Locus ID | 83596 |
UniProt ID | Q9HB09 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of a family of proteins containing a Bcl-2 homology domain 2 (BH2). The encoded protein is an anti-apoptotic factor that acts as an inhibitor of caspases 3 and 7 in the cytoplasm. In the nucleus, it binds to the p53 tumor suppressor protein, preventing its association with target genes. Overexpression of this gene has been detected in a number of different cancers. There is a pseudogene for this gene on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (8) uses an alternate splice site and lacks an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (5) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它BCL2L12产品
Customer
Reviews
Loading...