ASZ1 (NM_001301822) Human Untagged Clone

CAT#: SC334937

ASZ1 (untagged) - Human ankyrin repeat, SAM and basic leucine zipper domain containing 1 (ASZ1), transcript variant 4



  "NM_001301822" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-ASZ1 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALP1; ANKL1; C7orf7; CT1.19; GASZ; Orf3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301822, the custom clone sequence may differ by one or more nucleotides


ATGCTACAAACCAAAGATGGAAAGATGCCAAGTGAGATTGCAAAAAGAAACAAACATCATGAGATCTTCA
ACTTACTTTCTTTTACTTTAAATCCATTGGAAGGAAAACTTCAACAGCTAACTAAAGAAGACACTATTTG
TAAAATATTGACAACAGATTCTGATAGAGAAAAAGATCACATTTTTAGTTCATATACAGCATTTGGAGAT
CTGGAAGTATTTTTACATGGTCTTGGACTTGAACATATGACAGATTTACTAAAGGAAAGGGATATAACGT
TAAGACATCTTTTGACCATGAGGGAAGATGAATTTACAAAGAATGGAATTACCAGTAAAGACCAGCAGAA
AATTCTGGCTGCTCTTAAAGAACTACAGGTAGAAGAGATACAATTTGGAGAGCTATCTGAAGAGACAAAG
TTGGAAATCAGTGGTGATGAGTTCCTCAACTTTCTTCTCAAATTAAATAAACAGTGTGGCCATTTAATAA
CAGCTGTACAGAATGTTATTACTGAGTTACCTGTAAATTCTCAAAAGATAACACTGGAATGGGCTTCTCC
CCAGAATTTTACTTCAGTTTGTGAAGAATTGGTTAATAATGTTGAAGATTTGAGTGAAAAGGTCTGCAAA
CTAAAAGACCTAATTCAAAAGTTGCAAAATGAACGGGAAAATGATCCAACTCATATACAATTAAGGGAAG
AAGTATCTACATGGAATAGTAGAATTTTGAAGAGGACAGCTATTACCATATGCGGATTCGGTTTTCTTCT
TTTCATTTGCAAGCTAACTTTCCAGAGGAAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001301822
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301822.1, NP_001288751.1
RefSeq Size 1753 bp
RefSeq ORF 804 bp
Locus ID 136991
UniProt ID Q8WWH4
Gene Summary Plays a central role during spermatogenesis by repressing transposable elements and preventing their mobilization, which is essential for the germline integrity. Acts via the piRNA metabolic process, which mediates the repression of transposable elements during meiosis by forming complexes composed of piRNAs and Piwi proteins and governs the methylation and subsequent repression of transposons. Its association with pi-bodies suggests a participation in the primary piRNAs metabolic process. Required prior to the pachytene stage to facilitate the production of multiple types of piRNAs, including those associated with repeats involved in the regulation of retrotransposons. May act by mediating protein-protein interactions during germ cell maturation (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon compared to variant 1. It encodes isoform 3 which has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...