TMEM106A (NM_001291586) Human Untagged Clone

CAT#: SC334905

TMEM106A (untagged) - Human transmembrane protein 106A (TMEM106A), transcript variant 1



  "NM_001291586" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal TMEM106A Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001291586, the custom clone sequence may differ by one or more nucleotides


ATGGGTAAGACGTTTTCCCAGCTGGGCTCTTGGCGGGAGGATGAGAACAAGTCAATCCTGTCCTCCAAAC
CAGCCATTGGCAGCAAGGCTGTCAACTACTCCAGCACCGGTAGCAGCAAGTCTTTTTGTTCCTGTGTGCC
TTGTGAAGGAACTGCTGATGCCAGCTTCGTGACTTGTCCCACCTGCCAGGGCAGTGGCAAGATTCCCCAA
GAGCTGGAGAAGCAGTTGGTGGCTCTCATTCCCTATGGGGACCAGAGGCTGAAGCCCAAGCACACGAAGC
TCTTTGTGTTCCTGGCCGTGCTCATCTGCCTGGTGACCTCCTCCTTCATCGTCTTTTTCCTGTTTCCCCG
GTCCGTCATTGTGCAGCCTGCAGGCCTCAACTCCTCCACAGTGGCCTTTGATGAGGCTGATATCTACCTC
AACATAACGAATATCTTAAACATCTCCAATGGCAACTACTACCCCATTATGGTGACACAGCTGACCCTCG
AGGTTCTGCACCTGTCCCTCGTGGTGGGGCAGGTTTCCAACAACCTTCTCCTACACATTGGCCCTTTGGC
CAGTGAACAGATGTTTTACGCAGTAGCTACCAAGATACGGGATGAAAACACATACAAAATCTGTACCTGG
CTGGAAATCAAAGTCCACCATGTGCTTTTGCACATCCAGGGCACCCTGACCTGTTCATACCTGAGCCATT
CAGAGCAGCTGGTCTTTCAGAGCTATGAATATGTGGACTGCCGAGGAAACGCATCTGTGCCCCACCAGCT
GACCCCTCACCCACCATGA


Restriction Sites SgfI-MluI     
ACCN NM_001291586
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291586.1, NP_001278515.1
RefSeq Size 3348 bp
RefSeq ORF 789 bp
Locus ID 113277
UniProt ID Q96A25
Protein Families Transmembrane
Gene Summary Activates macrophages and polarizes them into M1-like macrophages through the activation of the MAPK and NF-kappaB signaling pathway. Upon activation, upregulates the expression of CD80, CD86, CD69 and MHC II on macrophages, and induces the release of pro-inflammatory cytokines such as TNF, IL1B, IL6, CCL2 and nitric oxide (By similarity). May play a role in inhibition of proliferation and migration (PubMed:30456879, PubMed:29131025).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Both variants 1 and 2 encode isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...