MBD3 (NM_001281454) Human Untagged Clone

CAT#: SC334891

MBD3 (untagged) - Human methyl-CpG binding domain protein 3 (MBD3), transcript variant 2



  "NM_001281454" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
MDB3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001281454, the custom clone sequence may differ by one or more nucleotides


ATGGAGCGGAAGAGCCCGAGCGGGAAGAAGTTCCGCAGCAAGCCGCAGCTGGCGCGCTACCTGGGCGGCT
CCATGGACCTGAGCACCTTCGACTTCCGCACGGGCAAGATGCTGATGAGCAAGATGAACAAGAGCCGCCA
GCGCGTGCGCTACGACTCCTCCAACCAGGTCAAGGGCAAGCCCGACCTGAACACGGCGCTGCCCGTGCGC
CAGACGGCGTCCATCTTCAAGCAGCCGGTGACCAAGATTACCAACCACCCCAGCAACAAGGTCAAGAGCG
ACCCGCAGAAGGCGGTGGACCAGCCGCGCCAGCTCTTCTGGGAGAAGAAGCTGAGCGGCCTGAACGCCTT
CGACATTGCTGAGGAGCTGGTCAAGACCATGGACCTCCCCAAGGGCCTGCAGGGGGTGGGACCTGGCTGC
ACGGATGAGACGCTGCTGTCGGCCATCGCCAGCGCCCTGCACACTAGCACCATGCCCATCACGGGACAGC
TCTCGGCCGCCGTGGAGAAGAACCCCGGCGTATGGCTCAACACCACGCAGCCCCTGTGCAAAGCCTTCAT
GGTGACCGACGAGGACATCAGGAAGCAGGAAGAGCTGGTGCAGCAGGTGCGGAAGCGGCTGGAGGAGGCG
CTGATGGCCGACATGCTGGCGCACGTGGAGGAGCTGGCCCGTGACGGGGAGGCGCCGCTGGACAAGGCCT
GCGCTGAGGACGACGACGAGGAAGACGAGGAGGAGGAGGAGGAGGAGCCCGACCCGGACCCGGAGATGGA
GCACGTCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001281454
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001281454.1, NP_001268383.1
RefSeq Size 2417 bp
RefSeq ORF 780 bp
Locus ID 53615
UniProt ID O95983
Protein Families Druggable Genome, Transcription Factors
Gene Summary DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. This gene belongs to a family of nuclear proteins which are characterized by the presence of a methyl-CpG binding domain (MBD). The encoded protein is a subunit of the NuRD, a multisubunit complex containing nucleosome remodeling and histone deacetylase activities. Unlike the other family members, the encoded protein is not capable of binding to methylated DNA. The protein mediates the association of metastasis-associated protein 2 with the core histone deacetylase complex. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. It encodes isoform 2, which lacks an internal segment and is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...