PARP11 (NM_001286522) Human Untagged Clone

CAT#: SC334881

PARP11 (untagged) - Human poly (ADP-ribose) polymerase family, member 11 (PARP11), transcript variant 3



  "NM_001286522" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-PARP11 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARTD11; C12orf6; MIB006
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286522, the custom clone sequence may differ by one or more nucleotides


ATGTGGGAAGTGGCACATGTTTCAGAAATGAAGCAAATGAATCTCACCACTGGAAAGCAGCGCTTAATAA
AAAGAGCCCCCTTTTCTATCAGTGCTTTCAGTTACATCTGTGAAAACGAGGCCATCCCTATGCCACCACA
CTGGGAGAATGTGAATACTCAAGTACCATATCAGCTTATTCCTCTGCACAATCAAACACATGAATATAAT
GAAGTTGCTAATCTCTTTGGGAAGACGATGGATCGCAACCGAATTAAAAGAATTCAGAGAATTCAAAACC
TAGATTTGTGGGAGTTCTTTTGCAGGAAAAAGGCTCAGCTCAAGAAAAAAAGAGGTGTGCCTCAGATTAA
TGAACAAATGCTGTTTCATGGTACCAGCAGTGAATTTGTGGAAGCAATCTGCATTCATAACTTTGATTGG
AGAATAAATGGTATACATGGTGCTGTCTTTGGAAAAGGAACCTATTTTGCTAGAGATGCTGCTTATTCCA
GTCGTTTCTGCAAAGATGACATAAAGCATGGGAACACATTCCAAATTCATGGTGTCAGCTTGCAACAGCG
GCATCTGTTTAGAACATATAAATCTATGTTTCTTGCTCGAGTGCTAATTGGAGATTACATAAACGGAGAC
TCCAAATACATGCGACCTCCTTCCAAAGACGGGAGCTATGTGAATTTATATGACAGCTGTGTGGATGATA
CCTGGAACCCAAAGATCTTTGTGGTTTTTGATGCCAACCAAATCTATCCTGAGTACTTGATAGACTTTCA
TTGA


Restriction Sites SgfI-MluI     
ACCN NM_001286522
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286522.1, NP_001273451.1
RefSeq Size 4499 bp
RefSeq ORF 774 bp
Locus ID 57097
UniProt ID Q9NR21
Gene Summary Mono-ADP-ribosyltransferase that mediates mono-ADP-ribosylation of target proteins (PubMed:25043379, PubMed:25673562). Plays a role in nuclear envelope stability and nuclear remodeling during spermiogenesis (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains an alternate exon and lacks an exon in the 5' coding region, and initiates translation at an alternate downstream start codon, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform 1. Variants 2 and 3 encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...