RWDD3 (NM_001278248) Human Untagged Clone
CAT#: SC334846
RWDD3 (untagged) - Human RWD domain containing 3 (RWDD3), transcript variant 5
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
RWDD3 mouse monoclonal antibody,clone OTI10H4
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RSUME |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278248, the custom clone sequence may differ by one or more nucleotides
ATGTTTCTTTCCTGTGGTTCCCTGCACCAGAGAGGACCCGAGACAGATGGGACCGTGTTCAGAATTCACA CAAAAGCTGAAGGATTTATGGATGCGGATATACCTCTGGAATTGGTGTTCCATTTGCCAGTCAATTATCC TTCATGTCTACCTGGTATCTCGATTAACTCTGAACAGTTGACCAGGGCCCAGTGTGTGACTGTGAAAGAG AATTTACTTGAGCAAGCAGAGAGCCTTTTGTCGGAGCCTATGGTTCATGAGCTGGTTCTCTGGATTCAGC AGAATCTCAGGCATATCCTCAGCCAACCAGAAACTGGCAGTGGCAGTGAAAAGTGTACTTTTTCAACAAG CACGACCATGGATGATGGATTGTGGATAACTCTTTTGCATTTAGATCACATGAGAGCAAAGACTAAATAT GTCAAAATTGTGGAGAAGTGGGCTTCAGATTTAAGGCTGACAGGAAGACTGATGTTCATGGGTAAAATAA TACTGATTTTACTACAGGGAGACAGAAACAACCTCAAGGAGTACTTGATTCTTCAGAAAACCTCCAAAGT AGATGTGGACTCAAGTGGAAAGAAATGCAAAGAGAAAATGATTAGTGTACTGTTTGAAACAAAAGTACAG ACAGAACACAAAAGGTTTCTGGCATTTGAAGTCAAAGAGTATTCAGCGTTGGATGAATTACAAAAGGAAT TTGAAACTGCAGGACTTAAGAAGCTTTTCTCCGAATTTGTACTTGCTCTGGTAAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278248 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278248.1, NP_001265177.1 |
RefSeq Size | 1383 bp |
RefSeq ORF | 759 bp |
Locus ID | 25950 |
UniProt ID | Q9Y3V2 |
Gene Summary | Enhancer of SUMO conjugation. Via its interaction with UBE2I/UBC9, increases SUMO conjugation to proteins by promoting the binding of E1 and E2 enzymes, thioester linkage between SUMO and UBE2I/UBC9 and transfer of SUMO to specific target proteins which include HIF1A, PIAS, NFKBIA, NR3C1 and TOP1. Isoform 1 and isoform 2 positively regulate the NF-kappa-B signaling pathway by enhancing the sumoylation of NF-kappa-B inhibitor alpha (NFKBIA), promoting its stabilization which consequently leads to an increased inhibition of NF-kappa-B transcriptional activity. Isoform 1 and isoform 2 negatively regulate the hypoxia-inducible factor-1 alpha (HIF1A) signaling pathway by increasing the sumoylation of HIF1A, promoting its stabilization, transcriptional activity and the expression of its target gene VEGFA during hypoxia. Isoform 2 promotes the sumoylation and transcriptional activity of the glucocorticoid receptor NR3C1 and enhances the interaction of SUMO1 and NR3C1 with UBE2I/UBC9. Has no effect on ubiquitination.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (5) contains an alternate exon in the 5' region, and initiates translation at an alternate start site, compared to variant 1. The encoded isoform (e) is shorter and has a distinct N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...