RHD (NM_001282867) Human Untagged Clone
CAT#: SC334826
RHD (untagged) - Human Rh blood group, D antigen (RHD), transcript variant 3
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD240D; DIIIc; RH; Rh4; RH30; RHCED; RhDCw; RHDel; RHDVA(TT); RhII; RhK562-II; RhPI; RHPII; RHXIII |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282867, the custom clone sequence may differ by one or more nucleotides
ATGAACATGATGCACATCTACGTGTTCGCAGCCTATTTTGGGCTGTCTGTGGCCTGGTGCCTGCCAAAGC CTCTACCCGAGGGAACGGAGGATAAAGATCAGACAGCAACGATACCCAGTTTGTCTGCCATGCTGGGCGC CCTCTTCTTGTGGATGTTCTGGCCAAGTTTCAACTCTGCTCTGCTGAGAAGTCCAATCGAAAGGAAGAAT GCCGTGTTCAACACCTACTATGCTGTAGCAGTCAGCGTGGTGACAGCCATCTCAGGGTCATCCTTGGCTC ACCCCCAAGGGAAGATCAGCAAGACTTATGTGCACAGTGCGGTGTTGGCAGGAGGCGTGGCTGTGGGTAC CTCGTGTCACCTGATCCCTTCTCCGTGGCTTGCCATGGTGCTGGGTCTTGTGGCTGGGCTGATCTCCGTC GGGGGAGCCAAGTACCTGCCGGGGTGTTGTAACCGAGTGCTGGGGATTCCCCACAGCTCCATCATGGGCT ACAACTTCAGCTTGCTGGGTCTGCTTGGAGAGATCATCTACATTGTGCTGCTGGTGCTTGATACCGTCGG AGCCGGCAATGGCATGATTGGCTTCCAGGTCCTCCTCAGCATTGGGGAACTCAGCTTGGCCATCGTGATA GCTCTCACGTCTGGTCTCCTGACAGGTTTGCTCCTAAATCTTAAAATATGGAAAGCACCTCATGAGGCTA AATATTTTGATGACCAAGTTTTCTGGAAGTTTCCTCATTTGGCTGTTGGATTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282867 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282867.1, NP_001269796.1 |
RefSeq Size | 2833 bp |
RefSeq ORF | 756 bp |
Locus ID | 6007 |
Protein Families | Transmembrane |
Gene Summary | The Rh blood group system is the second most clinically significant of the blood groups, second only to ABO. It is also the most polymorphic of the blood groups, with variations due to deletions, gene conversions, and missense mutations. The Rh blood group includes this gene, which encodes the RhD protein, and a second gene that encodes both the RhC and RhE antigens on a single polypeptide. The two genes, and a third unrelated gene, are found in a cluster on chromosome 1. The classification of Rh-positive and Rh-negative individuals is determined by the presence or absence of the highly immunogenic RhD protein on the surface of erythrocytes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) uses an alternate splice junction at the 5' end of an exon compared to variant 1. This difference causes translation initiation at a downstream AUG and results in an isoform (3) with a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...