SLC35D2 (NM_001286990) Human Untagged Clone
CAT#: SC334817
SLC35D2 (untagged) - Human solute carrier family 35 (UDP-GlcNAc/UDP-glucose transporter), member D2 (SLC35D2), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hfrc; HFRC1; SQV7L; UGTrel8 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286990, the custom clone sequence may differ by one or more nucleotides
ATGACGGCCGGCGGCCAGGCCGAGGCCGAGGGCGCTGGCGGGGAGCCCGGCGCGGCGCGGCTGCCCTCGC GGGTGGCCCGGCTGCTGTCGGCGCTCTTCTACGGGACCTGCTCCTTCCTCATCGTGCTTGTCAACAAGGC GCTGCTGACCACCTACGGTTTCCCGTCACCAATTTTCCTTGGAATTGGACAGATGGCAGCCACCATAATG ATACTATATGTGTCCAAGCTAAACAAAATCATTCACTTCCCTGATTTTGATAAGAAAATTCCTGTAAAGC TGTTTCCTCTGCCTCTCCTCTACGTTGGAAACCACATAAGTGGATTATCAAGCACAAGTAAATTAAGCCT ACCGATGTTCACCGTGCTCAGGAAATTCACCATTCCACTTACCTTACTTCTGGAAACCATCATACTTGGG AAGCAGTATTCACTCAACATCATCCTCAGTGTCTTTGCCATTATTCTCGGGGCTTTCATAGCAGCTGGGT TTCTGCTGATGTACTCCACGGTTCTGTGCAGCTATTACAATTCAGCCCTGACGACAGCAGTGGTTGGAGC CATCAAGAATGTATCCGTTGCCTACATTGGGATATTAATCGGTGGAGACTACATTTTCTCTTTGTTAAAC TTTGTAGGGTTAAATATTTGCATGGCAGGGGGCTTGAGATATTCCTTTTTAACACTGAGCAGCCAGTTAA AACCTAAACCTGTGGGTGAAGAAAACATCTGTTTGGATTTGAAGAGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286990 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286990.1, NP_001273919.1 |
RefSeq Size | 1379 bp |
RefSeq ORF | 750 bp |
Locus ID | 11046 |
UniProt ID | Q76EJ3 |
Protein Families | Transmembrane |
Gene Summary | Nucleotide sugars, which are synthesized in the cytosol or the nucleus, are high-energy donor substrates for glycosyltransferases located in the lumen of the endoplasmic reticulum and Golgi apparatus. Translocation of nucleotide sugars from the cytosol into the lumen compartment is mediated by specific nucleotide sugar transporters, such as SLC35D2 (Suda et al., 2004 [PubMed 15082721]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (2) lacks three alternate exons that result in the loss of an in-frame segment in the central coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236923 | SLC35D2 (myc-DDK-tagged) - Human solute carrier family 35 (UDP-GlcNAc/UDP-glucose transporter), member D2 (SLC35D2), transcript variant 2 |
CNY 3990.00 |
|
RG236923 | SLC35D2 (tGFP-tagged) - Human solute carrier family 35 (UDP-GlcNAc/UDP-glucose transporter), member D2 (SLC35D2), transcript variant 2 |
CNY 4370.00 |
其它SLC35D2产品