CHRNA10 (NM_001303034) Human Untagged Clone

CAT#: SC334780

CHRNA10 (untagged) - Human cholinergic receptor, nicotinic, alpha 10 (neuronal) (CHRNA10), transcript variant 2



  "NM_001303034" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-CHRNA10 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001303034, the custom clone sequence may differ by one or more nucleotides


ATGCCGGCGCGGCGGCGCGTGCTCACCTACGGCTGCTGCTCCGAGCCCTACCCCGACGTCACCTTCACGC
TGCTGCTGCGCCGCCGCGCCGCCGCCTACGTGTGCAACCTGCTGCTGCCCTGCGTGCTCATCTCGCTGCT
TGCGCCGCTCGCCTTCCACCTGCCTGCCGACTCAGGCGAGAAGGTGTCGCTGGGCGTCACCGTGCTGCTG
GCGCTCACCGTCTTCCAGTTGCTGCTGGCCGAGAGCATGCCACCGGCCGAGAGCGTGCCGCTCATCGGGA
AGTACTACATGGCCACTATGACCATGGTCACATTCTCAACAGCACTCACCATCCTTATCATGAACCTGCA
TTACTGTGGTCCCAGTGTCCGCCCAGTGCCAGCCTGGGCTAGGGCCCTCCTGCTGGGACACCTGGCACGG
GGCCTGTGCGTGCGGGAAAGAGGGGAGCCCTGTGGGCAGTCCAGGCCACCTGAGTTATCTCCTAGCCCCC
AGTCGCCTGAAGGAGGGGCTGGCCCCCCAGCGGGCCCTTGCCACGAGCCACGATGTCTGTGCCGCCAGGA
AGCCCTACTGCACCACGTAGCCACCATTGCCAATACCTTCCGCAGCCACCGAGCTGCCCAGCGCTGCCAT
GAGGACTGGAAGCGCCTGGCCCGTGTGATGGACCGCTTCTTCCTGGCCATCTTCTTCTCCATGGCCCTGG
TCATGAGCCTCCTGGTGCTGGTGCAGGCCCTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001303034
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001303034.1, NP_001289963.1
RefSeq Size 2024 bp
RefSeq ORF 735 bp
Locus ID 57053
UniProt ID Q9GZZ6
Protein Families Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
Gene Summary Ionotropic receptor with a probable role in the modulation of auditory stimuli. Agonist binding may induce an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. The channel is permeable to a range of divalent cations including calcium, the influx of which may activate a potassium current which hyperpolarizes the cell membrane. In the ear, this may lead to a reduction in basilar membrane motion, altering the activity of auditory nerve fibers and reducing the range of dynamic hearing. This may protect against acoustic trauma.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site at an internal exon compared to variant 1. This difference results in translation initiation at a downstream in-frame start site through ribosomal re-initiation or leaky scanning. The encoded isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...