CTRP5 (C1QTNF5) (NM_001278431) Human Untagged Clone

CAT#: SC334766

C1QTNF5 (untagged) - Human C1q and tumor necrosis factor related protein 5 (C1QTNF5), transcript variant 2



  "NM_001278431" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal CTRP5 Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CTRP5; MFRP
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001278431, the custom clone sequence may differ by one or more nucleotides


ATGAGGCCACTCCTCGTCCTGCTGCTCCTGGGCCTGGCGGCCGGCTCGCCCCCACTGGACGACAACAAGA
TCCCCAGCCTCTGCCCGGGGCACCCCGGCCTTCCAGGCACGCCGGGCCACCATGGCAGCCAGGGCTTGCC
GGGCCGCGATGGCCGCGACGGCCGCGACGGCGCGCCCGGGGCTCCGGGAGAGAAAGGCGAGGGCGGGAGG
CCGGGACTGCCGGGACCTCGAGGGGACCCCGGGCCGCGAGGAGAGGCGGGACCCGCGGGGCCCACCGGGC
CTGCCGGGGAGTGCTCGGTGCCTCCGCGATCCGCCTTCAGCGCCAAGCGCTCCGAGAGCCGGGTGCCTCC
GCCGTCTGACGCACCCTTGCCCTTCGACCGCGTGCTGGTGAACGAGCAGGGACATTACGACGCCGTCACC
GGCAAGTTCACCTGCCAGGTGCCTGGGGTCTACTACTTCGCCGTCCATGCCACCGTCTACCGGGCCAGCC
TGCAGTTTGATCTGGTGAAGAATGGCGAATCCATTGCCTCTTTCTTCCAGTTTTTCGGGGGGTGGCCCAA
GCCAGCCTCGCTCTCGGGGGGGGCCATGGTGAGGCTGGAGCCTGAGGACCAAGTGTGGGTGCAGGTGGGT
GTGGGTGACTACATTGGCATCTATGCCAGCATCAAGACAGACAGCACCTTCTCCGGATTTCTGGTGTACT
CCGACTGGCACAGCTCCCCAGTCTTTGCTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001278431
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278431.1, NP_001265360.1
RefSeq Size 1361 bp
RefSeq ORF 732 bp
Locus ID 114902
UniProt ID Q9BXJ0
Protein Families Secreted Protein
Gene Summary This gene encodes a member of a family of proteins that function as components of basement membranes and may play a role in cell adhesion. Mutations in this gene have been associated with late-onset retinal degeneration. The protein may be encoded by either a bicistronic transcript including sequence from the upstream membrane frizzled-related protein gene (MFRP), or by a monocistronic transcript expressed from an internal promoter. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (2) lacks multiple 5' exons and represents use of an internal promoter, compared to variant 1. This variant is a monocistronic transcript that only encodes the C1QTNF5 protein. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...