CTRP5 (C1QTNF5) (NM_001278431) Human Untagged Clone
CAT#: SC334766
C1QTNF5 (untagged) - Human C1q and tumor necrosis factor related protein 5 (C1QTNF5), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CTRP5; MFRP |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001278431, the custom clone sequence may differ by one or more nucleotides
ATGAGGCCACTCCTCGTCCTGCTGCTCCTGGGCCTGGCGGCCGGCTCGCCCCCACTGGACGACAACAAGA TCCCCAGCCTCTGCCCGGGGCACCCCGGCCTTCCAGGCACGCCGGGCCACCATGGCAGCCAGGGCTTGCC GGGCCGCGATGGCCGCGACGGCCGCGACGGCGCGCCCGGGGCTCCGGGAGAGAAAGGCGAGGGCGGGAGG CCGGGACTGCCGGGACCTCGAGGGGACCCCGGGCCGCGAGGAGAGGCGGGACCCGCGGGGCCCACCGGGC CTGCCGGGGAGTGCTCGGTGCCTCCGCGATCCGCCTTCAGCGCCAAGCGCTCCGAGAGCCGGGTGCCTCC GCCGTCTGACGCACCCTTGCCCTTCGACCGCGTGCTGGTGAACGAGCAGGGACATTACGACGCCGTCACC GGCAAGTTCACCTGCCAGGTGCCTGGGGTCTACTACTTCGCCGTCCATGCCACCGTCTACCGGGCCAGCC TGCAGTTTGATCTGGTGAAGAATGGCGAATCCATTGCCTCTTTCTTCCAGTTTTTCGGGGGGTGGCCCAA GCCAGCCTCGCTCTCGGGGGGGGCCATGGTGAGGCTGGAGCCTGAGGACCAAGTGTGGGTGCAGGTGGGT GTGGGTGACTACATTGGCATCTATGCCAGCATCAAGACAGACAGCACCTTCTCCGGATTTCTGGTGTACT CCGACTGGCACAGCTCCCCAGTCTTTGCTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278431 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278431.1, NP_001265360.1 |
RefSeq Size | 1361 bp |
RefSeq ORF | 732 bp |
Locus ID | 114902 |
UniProt ID | Q9BXJ0 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a member of a family of proteins that function as components of basement membranes and may play a role in cell adhesion. Mutations in this gene have been associated with late-onset retinal degeneration. The protein may be encoded by either a bicistronic transcript including sequence from the upstream membrane frizzled-related protein gene (MFRP), or by a monocistronic transcript expressed from an internal promoter. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (2) lacks multiple 5' exons and represents use of an internal promoter, compared to variant 1. This variant is a monocistronic transcript that only encodes the C1QTNF5 protein. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236872 | C1QTNF5 (myc-DDK-tagged) - Human C1q and tumor necrosis factor related protein 5 (C1QTNF5), transcript variant 2 |
CNY 2400.00 |
|
RG236872 | C1QTNF5 (tGFP-tagged) - Human C1q and tumor necrosis factor related protein 5 (C1QTNF5), transcript variant 2 |
CNY 4370.00 |