TM4SF19 (NM_001204897) Human Untagged Clone

CAT#: SC334765

TM4SF19 (untagged) - Human transmembrane 4 L six family member 19 (TM4SF19), transcript variant 2



  "NM_001204897" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TM4SF19 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms OCTM4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001204897, the custom clone sequence may differ by one or more nucleotides


ATGGTGTCCTCTCCCTGCACGCAGGCAAGCTCACGGACTTGCTCCCGTATCCTGGGACTGAGCCTTGGGA
CTGCAGCCCTGTTTGCTGCTGGGGCCAACGTGGCACTCCTCCTTCCTAACTGGGATGTCACCTACCTGTT
GAGGGGCCTCCTTGGCAGGCATGCCATGCTGGGAACTGGGCTCTGGGGAGGAGGCCTCATGGTACTCACT
GCAGCTATCCTCATCTCCTTGATGGGCTGGAGATACGGCTGCTTCAGTAAGAGTGGGCTCTGTCGAAGCG
TGCTTACTGCTCTGTTGTCAGGTGGCCTGGCTTTACTTGGAGCCCTGATTTGCTTTGTCACTTCTGGAGT
TGCTCTGAAAGATGGTCCTTTTTGCATGTTTGATGTTTCATCCTTCAATCAGACACAAGCTTGGAAATAT
GGTTACCCATTCAAAGACCTGCATAGAATTATCTGTATGACCGTTCGCTCTGGAACTCCGTCTGCCTGGA
GCCCTCTGCAGCTGTTGTCTGGCACGTGTCCCTCTTCTCCGCCCTTCTGTGCATCAGCCTGCTCCAGCTT
CTCCTGGTGGTCGTTCATGTCATCAACAGCCTCCTGGGCCTTTTCTGCAGCCTCTGCGAGAAGTGACAGG
CAGAACCTTCACTTGCAAGCATGGGTGTTTTCATCATCGGCTGTCTTGAATCCTTTCTACAAGGAGTGGG
TACGAATTATAAACAAACTTCCCCTTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001204897
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001204897.1, NP_001191826.1
RefSeq Size 1073 bp
RefSeq ORF 729 bp
Locus ID 116211
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is a member of the four-transmembrane L6 superfamily. Members of this family function in various cellular processes including cell proliferation, motility, and adhesion via their interactions with integrins. In human brain tissue, this gene is expressed at high levels in the parietal lobe, occipital lobe, hippocampus, pons, white matter, corpus callosum, and cerebellum. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2017]
Transcript Variant: This variant (2) uses an alternate splice site that causes a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is longer than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...