PSG9 (NM_001301709) Human Untagged Clone
CAT#: SC334741
PSG9 (untagged) - Human pregnancy specific beta-1-glycoprotein 9 (PSG9), transcript variant 4
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PS34; PSBG-9; PSBG-11; PSG11; PSGII |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001301709, the custom clone sequence may differ by one or more nucleotides
ATGGGGCCCCTCCCAGCCCCTTCCTGCACACAGCGCATCACCTGGAAGGGGCTCCTGCTCACAGCATCAC TTTTAAACTTCTGGAACCCGCCCACCACTGCCGAAGTCACGATTGAAGCCCAGCCACCCAAAGTTTCTGA GGGGAAGGATGTTCTTCTACTTGTCCACAATTTGCCCCAGAATCTTCCTGGCTACTTCTGGTACAAAGGG GAAATGACGGACCTCTACCATTACATTATATCGTATATAGTTGATGGTAAAATAATTATATATGGGCCTG CATACAGTGGAAGAGAAACAGTATATTCCAACGCATCCCTGCTGATCCAGAATGTCACCCGGAAGGATGC AGGAACCTACACCTTACACATCATAAAGCGAGGTGATGAGACTAGAGAAGAAATTCGACATTTCACCTTC ACCTTATACTATGGTCCAGACCTCCCCAGAATTTACCCTTCATTCACCTATTACCGTTCAGGAGAAAACC TCGACTTGTCCTGCTTCACGGAATCTAACCCACCGGCAGAGTATTTTTGGACAATTAATGGGAAGTTTCA GCAATCAGGACAAAAGCTCTTTATCCCCCAAATTACTAGAAATCATAGCGGGCTCTATGCTTGCTCTGTT CATAACTCAGCCACTGGCAAGGAAATCTCCAAATCCATGACAGTCAAAGTCTCTGGTCCCTGCCATGGAG ACCTGACAGAGTCTCAGTCATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301709 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001301709.1, NP_001288638.1 |
RefSeq Size | 1209 bp |
RefSeq ORF | 723 bp |
Locus ID | 5678 |
UniProt ID | Q00887 |
Protein Families | Secreted Protein |
Gene Summary | The protein encoded by this gene is a member of the pregnancy-specific glycoprotein (PSG) family. This protein family and the closely related carcinoembryonic antigen cell adhesion molecule (CEACAM) gene family are both members of the immunoglobulin superfamily, and are organized as a large gene cluster. This protein is thought to inhibit platelet-fibrinogen interactions. Several studies suggest that reduced serum concentrations of PSGs are associated with fetal growth restrictions, while up-regulation of this gene has been observed in colorectal cancers. Several pseudogenes of this gene are found on chromosome 19. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (4) lacks two consecutive, alternate in-frame exons in the coding region, compared to variant 1. It encodes isoform 4 which is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...