Hsp40 (DNAJB1) (NM_001300914) Human Untagged Clone

CAT#: SC334738

DNAJB1 (untagged) - Human DnaJ (Hsp40) homolog, subfamily B, member 1 (DNAJB1), transcript variant 2



  "NM_001300914" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
DNAJB1 (Hsp40) mouse monoclonal antibody, clone OTI1E9 (formerly 1E9)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Hdj1; Hsp40; HSPF1; RSPH16B; Sis1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300914, the custom clone sequence may differ by one or more nucleotides


ATGTTTGCTGAGTTCTTCGGTGGCAGAAATCCCTTTGACACCTTTTTTGGGCAGCGGAACGGGGAGGAAG
GCATGGACATTGATGACCCATTCTCTGGCTTCCCTATGGGCATGGGTGGCTTCACCAACGTGAACTTTGG
CCGCTCCCGCTCTGCCCAAGAGCCCGCCCGAAAGAAGCAAGATCCCCCAGTCACCCACGACCTTCGAGTC
TCCCTTGAAGAGATCTACAGCGGCTGTACCAAGAAGATGAAAATCTCCCACAAGCGGCTAAACCCCGACG
GAAAGAGCATTCGAAACGAAGACAAAATATTGACCATCGAAGTGAAGAAGGGGTGGAAAGAAGGAACCAA
AATCACTTTCCCCAAGGAAGGAGACCAGACCTCCAACAACATTCCAGCTGATATCGTCTTTGTTTTAAAG
GACAAGCCCCACAATATCTTTAAGAGAGATGGCTCTGATGTCATTTATCCTGCCAGGATCAGCCTCCGGG
AGGCTCTGTGTGGCTGCACAGTGAACGTCCCCACTCTGGACGGCAGGACGATACCCGTCGTATTCAAAGA
TGTTATCAGGCCTGGCATGCGGCGAAAAGTTCCTGGAGAAGGCCTCCCCCTCCCCAAAACACCCGAGAAA
CGTGGGGACCTCATTATTGAGTTTGAAGTGATCTTCCCCGAAAGGATTCCCCAGACATCAAGAACCGTAC
TTGAGCAGGTTCTTCCAATATAG


Restriction Sites SgfI-MluI     
ACCN NM_001300914
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001300914.1, NP_001287843.1
RefSeq Size 2270 bp
RefSeq ORF 723 bp
Locus ID 3337
UniProt ID P25685
Gene Summary This gene encodes a member of the DnaJ or Hsp40 (heat shock protein 40 kD) family of proteins. DNAJ family members are characterized by a highly conserved amino acid stretch called the 'J-domain' and function as one of the two major classes of molecular chaperones involved in a wide range of cellular events, such as protein folding and oligomeric protein complex assembly. The encoded protein is a molecular chaperone that stimulates the ATPase activity of Hsp70 heat-shock proteins in order to promote protein folding and prevent misfolded protein aggregation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 2, which has a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...