SLC25A30 (NM_001286806) Human Untagged Clone

CAT#: SC334734

SLC25A30 (untagged) - Human solute carrier family 25, member 30 (SLC25A30), transcript variant 2



  "NM_001286806" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
SLC25A30 Antibody - N-terminal region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KMCP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286806, the custom clone sequence may differ by one or more nucleotides


ATGTTGCACGCATTAGTGAGGATAGGCAGAGAAGAAGGGCTGAAAGCACTCTACTCGGGGATTGCCCCCG
CGATGTTACGCCAGGCATCCTATGGCACCATCAAGATAGGCACTTACCAGAGCTTGAAGCGACTATTCAT
TGAACGCCCAGAAGATGAAACTCTACCGATAAATGTGATATGTGGAATTCTGTCTGGAGTCATATCTTCA
ACCATTGCTAATCCAACTGATGTTTTGAAAATTCGGATGCAAGCGCAAAGCAACACCATTCAAGGAGGAA
TGATAGGCAACTTCATGAACATTTACCAGCAAGAGGGGACAAGAGGACTGTGGAAGGGTGTGTCCCTTAC
TGCGCAGAGGGCTGCTATTGTTGTTGGTGTGGAGCTGCCGGTCTATGACATCACCAAGAAGCATCTTATT
CTCTCAGGCCTGATGGGAGACACTGTGTATACCCACTTCCTCTCAAGCTTCACCTGTGGTCTGGCAGGGG
CCCTGGCCTCAAACCCTGTTGATGTTGTGAGGACACGTATGATGAATCAGAGAGTGCTTCGAGATGGCAG
ATGTTCTGGCTACACAGGAACCCTGGATTGCTTGTTACAGACATGGAAGAATGAAGGGTTTTTTGCTCTC
TATAAAGGCTTTTGGCCAAATTGGTTGAGACTTGGTCCTTGGAATATCATTTTCTTTGTGACATACGAGC
AGTTGAAGAAATTGGATTTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001286806
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286806.1, NP_001273735.1
RefSeq Size 3626 bp
RefSeq ORF 723 bp
Locus ID 253512
UniProt ID Q5SVS4
Gene Summary Although the outer mitochondrial membrane is permeable to many small metabolites, transport of solutes across the inner mitochondrial membrane is achieved by members of the mitochondrial carrier protein family, such as SLC25A30 (Haguenauer et al., 2005 [PubMed 15809292]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation from a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...