MAST4 (NM_001290228) Human Untagged Clone

CAT#: SC334720

MAST4 (untagged) - Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 6



  "NM_001290228" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal anti-MAST4 antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001290228, the custom clone sequence may differ by one or more nucleotides


ATGGGGGAGAAAGTTTCGGAGGCGCCAGAGCCGGTGCCCCGCGGCTGCAGTGGCCACGGCAGCCGGACTC
CAGCCTCTGCGCTGGTCGCCGCGTCCTCTCCGGGTGCTTCCTCGGCCGAGTCCTCCTCGGGCTCAGAAAC
TCTGTCGGAGGAAGGGGAGCCCGGCGGCTTCTCCAGAGAGCATCAGCCGCCGCCGCCGCCGCCGTTGGGA
GGCACCCTGGGCGCCCGGGCGCCCGCCGCGTGGGCTCCGGCAAGCGTGCTGCTGGAGCGCGGAGTCCTTG
CGCTGCCGCCGCCGCTTCCCGGAGGAGCTGTGCCGCCCGCGCCCCGGGGCAGCAGCGCGTCCCAGGAGGA
GCAGGACGAGGAGCTTGACCACATATTATCCCCTCCACCCATGCCGTTTCGGAAATGCAGCAACCCAGAT
GTGGCTTCTGGCCCTGGAAAATCACTGAAGTATAAAAGACAGCTGAGTGAGGATGGAAGACAGCTAAGGC
GAGGGAGCCTGGGAGGAGCCCTGACTGGGAGGTACCTTCTTCCAAACCCGGTGGCGGGACAGGCCTGGCC
GGCCTCTGCAGAGACGTCCAACCTCGTGCGCATGCGCAGCCAGGCCCTGGGCCAGTCGGCGCCCTCGCTC
ACCGCCAGCCTGAAGGAGCTGAGTCTCCCCAGAAGAGGAAGTTTCCCTGTGTGTCCAAATGCTGGGAGAA
CATCACCCCTTGGATGA


Restriction Sites SgfI-MluI     
ACCN NM_001290228
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001290228.1, NP_001277157.1
RefSeq Size 1062 bp
RefSeq ORF 717 bp
Locus ID 375449
UniProt ID O15021
Protein Families Druggable Genome, Protein Kinase
Gene Summary This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (6) uses a distinct 3' coding region and 3' UTR compared to variant 3. The encoded protein (isoform f) has a shorter and distinct C-terminus compared to isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...