UBXN1 (NM_001286078) Human Untagged Clone

CAT#: SC334718

UBXN1 (untagged) - Human UBX domain protein 1 (UBXN1), transcript variant 3



  "NM_001286078" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


UBXN1 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 2B28; SAKS1; UBXD10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286078, the custom clone sequence may differ by one or more nucleotides


ATGGCGGAGCTGACGGCTCTTGAGAGTCTCATCGAGATGGGCTTCCCCAGGGGACGCGCGGAGAAGGCTC
TGGCCCTCACAGGGAACCAGGGCATCGAGGCTGCGATGGACTGGATGTTGGAGCTGGTGGCCCAGAAGCA
GCGGGAGCGTGAAGAAAGAGAGGAACGGGAGGCATTGGAACGGGAACGGCAGCGCAGGAGACAAGGGCAA
GAGTTGTCAGCAGCACGACAGCGGCTACAGGAAGATGAGATGCGCCGGGCTGCTGAGGAGAGGCGGAGGG
AAAAGGCCGAGGAGTTAGCAGCCAGACAAAGAGTTAGAGAAAAGATCGAGAGGGACAAAGCAGAGAGAGC
CAAGAAGTATGGTGGCAGTGTGGGCTCTCAGCCACCCCCAGTGGCACCAGAGCCAGGTCCTGTTCCCTCT
TCTCCCAGCCAGGAGCCTCCCACCAAGCGGGAGTATGACCAGTGTCGCATACAGGTCAGGCTGCCAGATG
GGACCTCACTGACCCAGACGTTCCGGGCCCGGGAACAGCTGGCAGCTGTGAGGCTCTATGTGGAGCTCCA
CCGTGGGGAGGAACTAGGTGGGGGCCAGGACCCTGTGCAATTGCTCAGTGGCTTCCCCAGACGGGCCTTC
TCAGAAGCTGACATGGAGCGGCCTCTGCAGGAGCTGGGACTCGTGCCTTCTGCTGTTCTCATTGTGGCCA
AGAAATGTCCCAGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001286078
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286078.1, NP_001273007.1
RefSeq Size 1013 bp
RefSeq ORF 717 bp
Locus ID 51035
UniProt ID Q04323
Protein Families Druggable Genome
Gene Summary Ubiquitin-binding protein that plays a role in the modulation of innate immune response. Blocks both the RIG-I-like receptors (RLR) and NF-kappa-B pathways. Following viral infection, UBXN1 is induced and recruited to the RLR component MAVS. In turn, interferes with MAVS oligomerization, and disrupts the MAVS/TRAF3/TRAF6 signalosome. This function probably serves as a brake to prevent excessive RLR signaling (PubMed:23545497). Interferes with the TNFalpha-triggered NF-kappa-B pathway by interacting with cellular inhibitors of apoptosis proteins (cIAPs) and thereby inhibiting their recruitment to TNFR1 (PubMed:25681446). Prevents also the activation of NF-kappa-B by associating with CUL1 and thus inhibiting NF-kappa-B inhibitor alpha/NFKBIA degradation that remains bound to NF-kappa-B (PubMed:28152074). Interacts with the BRCA1-BARD1 heterodimer and regulates its activity. Specifically binds 'Lys-6'-linked polyubiquitin chains. Interaction with autoubiquitinated BRCA1 leads to the inhibition of the E3 ubiquitin-protein ligase activity of the BRCA1-BARD1 heterodimer (PubMed:20351172). Component of a complex required to couple deglycosylation and proteasome-mediated degradation of misfolded proteins in the endoplasmic reticulum that are retrotranslocated in the cytosol.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks two alternate in-frame exons in the 5' region and contains an alternate exon structure in the 3' region, compared to variant 1. The encoded isoform (3) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...