PSG7 (NM_001290042) Human Untagged Clone
CAT#: SC334712
PSG7 (untagged) - Human pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene) (PSG7), transcript variant 1, short
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PSBG-7; PSG1; PSGGA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001290042, the custom clone sequence may differ by one or more nucleotides
ATGAATGGTCAGAGCCTCCCTATGACTCACAGCTTGCAGCTGTCTGAAACCAACAGGACCCTCTACCTAT TTGGTGTCACAAACTATACTGCAGGACCCTATGAATGTGAAATACGGAACCCAGTGAGTGCCAGCCGCAG TGACCCAGTCACCCTGAATCTCCTCCCGAAGCTGCCCAAGCCCTACATCACCATCAATAACTTAAACCCC AGGGAGAATAAGGATGTCTCAACCTTCACCTGTGAACCTAAGAGTGAGAACTACACCTACATTTGGTGGC TAAATGGTCAGAGCCTCCCGGTCAGTCCCAGGGTAAAGCGACGCATTGAAAACAGGATCCTCATTCTACC CAGTGTCACGAGAAATGAAACAGGACCCTATCAATGTGAAATACGGGACCGATATGGTGGCATCCGCAGT GACCCAGTCACCCTGAATGTCCTCTATGGTCCAGACCTCCCCAGAATTTACCCTTCATTCACCTATTACC ATTCAGGACAAAACCTCTACTTGTCCTGCTTTGCGGACTCTAACCCACCGGCACAGTATTCTTGGACAAT TAATGGGAAGTTTCAGCTATCAGGACAAAAGCTTTCTATCCCCCAGATTACTACAAAGCATAGCGGGCTC TATGCTTGCTCTGTTCGTAACTCAGCCACTGGCAAGGAAAGCTCCAAATCCGTGACAGTCAGAGTCTCTG ACTGGACATTACCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001290042 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001290042.1, NP_001276971.1 |
RefSeq Size | 2046 bp |
RefSeq ORF | 717 bp |
Locus ID | 5676 |
Protein Families | Secreted Protein |
Gene Summary | This gene is a member of the pregnancy-specific glycoprotein (PSG) gene family. The PSG genes are a subgroup of the carcinoembryonic antigen (CEA) family of immunoglobulin-like genes, and are found in a gene cluster at 19q13.1-q13.2 telomeric to another cluster of CEA-related genes. The PSG genes are expressed by placental trophoblasts and released into the maternal circulation during pregnancy, and are thought to be essential for maintenance of normal pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014] Transcript Variant: This variant (1, short) differs at only 1 nt compared to variant 1, which causes translation initiation at a downstream AUG. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236818 | PSG7 (myc-DDK-tagged) - Human pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene) (PSG7), transcript variant 1, short |
CNY 3990.00 |
|
RG236818 | PSG7 (tGFP-tagged) - Human pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene) (PSG7), transcript variant 1, short |
CNY 4370.00 |