ACADM (NM_001286044) Human Untagged Clone

CAT#: SC334656

ACADM (untagged) - Human acyl-CoA dehydrogenase, C-4 to C-12 straight chain (ACADM), transcript variant 6



  "NM_001286044" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
ACADM mouse monoclonal antibody,clone OTI2G7
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACAD1; MCAD; MCADH
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286044, the custom clone sequence may differ by one or more nucleotides


ATGTGGATAACCAACGGAGGAAAAGCTAATTGGTATTTTTTATTGGCACGTTCTGATCCAGATCCTAAAG
CTCCTGCTAATAAAGCCTTTACTGGATTCATTGTGGAAGCAGATACCCCAGGAATTCAGATTGGGAGAAA
GGAATTAAACATGGGCCAGCGATGTTCAGATACTAGAGGAATTGTCTTCGAAGATGTGAAAGTGCCTAAA
GAAAATGTTTTAATTGGTGACGGAGCTGGTTTCAAAGTTGCAATGGGAGCTTTTGATAAAACCAGACCTG
TAGTAGCTGCTGGTGCTGTTGGATTAGCACAAAGAGCTTTGGATGAAGCTACCAAGTATGCCCTGGAAAG
GAAAACTTTCGGAAAGCTACTTGTAGAGCACCAAGCAATATCATTTATGCTGGCTGAAATGGCAATGAAA
GTTGAACTAGCTAGAATGAGTTACCAGAGAGCAGCTTGGGAGGTTGATTCTGGTCGTCGAAATACCTATT
ATGCTTCTATTGCAAAGGCATTTGCTGGAGATATTGCAAATCAGTTAGCTACTGATGCTGTGCAGATACT
TGGAGGCAATGGATTTAATACAGAATATCCTGTAGAAAAACTAATGAGGGATGCCAAAATCTATCAGATT
TATGAAGGTACTTCACAAATTCAAAGACTTATTGTAGCCCGTGAACACATTGACAAGTACAAAAATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001286044
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286044.1, NP_001272973.1
RefSeq Size 2353 bp
RefSeq ORF 699 bp
Locus ID 34
Protein Families Druggable Genome
Protein Pathways beta-Alanine metabolism, Fatty acid metabolism, Metabolic pathways, PPAR signaling pathway, Propanoate metabolism, Valine, leucine and isoleucine degradation
Gene Summary This gene encodes the medium-chain specific (C4 to C12 straight chain) acyl-Coenzyme A dehydrogenase. The homotetramer enzyme catalyzes the initial step of the mitochondrial fatty acid beta-oxidation pathway. Defects in this gene cause medium-chain acyl-CoA dehydrogenase deficiency, a disease characterized by hepatic dysfunction, fasting hypoglycemia, and encephalopathy, which can result in infantile death. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (6) uses an alternate 5' structure that results in the use downstream AUG compared to variant 1. The encoded isoform (e) has a shorter N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...