ACADM (NM_001286044) Human Untagged Clone
CAT#: SC334656
ACADM (untagged) - Human acyl-CoA dehydrogenase, C-4 to C-12 straight chain (ACADM), transcript variant 6
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
ACADM mouse monoclonal antibody,clone OTI2G7
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ACAD1; MCAD; MCADH |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286044, the custom clone sequence may differ by one or more nucleotides
ATGTGGATAACCAACGGAGGAAAAGCTAATTGGTATTTTTTATTGGCACGTTCTGATCCAGATCCTAAAG CTCCTGCTAATAAAGCCTTTACTGGATTCATTGTGGAAGCAGATACCCCAGGAATTCAGATTGGGAGAAA GGAATTAAACATGGGCCAGCGATGTTCAGATACTAGAGGAATTGTCTTCGAAGATGTGAAAGTGCCTAAA GAAAATGTTTTAATTGGTGACGGAGCTGGTTTCAAAGTTGCAATGGGAGCTTTTGATAAAACCAGACCTG TAGTAGCTGCTGGTGCTGTTGGATTAGCACAAAGAGCTTTGGATGAAGCTACCAAGTATGCCCTGGAAAG GAAAACTTTCGGAAAGCTACTTGTAGAGCACCAAGCAATATCATTTATGCTGGCTGAAATGGCAATGAAA GTTGAACTAGCTAGAATGAGTTACCAGAGAGCAGCTTGGGAGGTTGATTCTGGTCGTCGAAATACCTATT ATGCTTCTATTGCAAAGGCATTTGCTGGAGATATTGCAAATCAGTTAGCTACTGATGCTGTGCAGATACT TGGAGGCAATGGATTTAATACAGAATATCCTGTAGAAAAACTAATGAGGGATGCCAAAATCTATCAGATT TATGAAGGTACTTCACAAATTCAAAGACTTATTGTAGCCCGTGAACACATTGACAAGTACAAAAATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286044 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286044.1, NP_001272973.1 |
RefSeq Size | 2353 bp |
RefSeq ORF | 699 bp |
Locus ID | 34 |
Protein Families | Druggable Genome |
Protein Pathways | beta-Alanine metabolism, Fatty acid metabolism, Metabolic pathways, PPAR signaling pathway, Propanoate metabolism, Valine, leucine and isoleucine degradation |
Gene Summary | This gene encodes the medium-chain specific (C4 to C12 straight chain) acyl-Coenzyme A dehydrogenase. The homotetramer enzyme catalyzes the initial step of the mitochondrial fatty acid beta-oxidation pathway. Defects in this gene cause medium-chain acyl-CoA dehydrogenase deficiency, a disease characterized by hepatic dysfunction, fasting hypoglycemia, and encephalopathy, which can result in infantile death. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (6) uses an alternate 5' structure that results in the use downstream AUG compared to variant 1. The encoded isoform (e) has a shorter N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...