Chimaerin 2 (CHN2) (NM_001293078) Human Untagged Clone
CAT#: SC334624
CHN2 (untagged) - Human chimerin 2 (CHN2), transcript variant 11
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARHGAP3; BCH; CHN2-3; RHOGAP3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001293078, the custom clone sequence may differ by one or more nucleotides
ATGTTCTCTGAAGAACTGTGGCTGGAAAATGAGAAAAAGTGTGCTGTGGTTCGGAAGTCTAAGCAGGGCA GGAAACGCCAAGAACTGCTGGCCGTAGCCTTCGGGGTGAAGGTGGGTGTCAAAGGCGGCTTTCTTTGGCC CCCTCTCAAACTCTTTGCCTGTTCACAGATCTCCTCCCTGGTTCGAAGGGCTGCCCTCACACACAACGAC AACCACTTCAATTATGAGAAGACACACAACTTTAAGGTCCACACGTTCCGAGGCCCACACTGGTGTGAAT ATTGTGCCAATTTCATGTGGGGGCTCATCGCCCAAGGGGTCCGGTGCTCAGGATTAAAATCGGAAGGCCT TTACAGAGTCTCTGGGTTCACTGAACACATTGAAGATGTCAAAATGGCATTTGACAGAGAAATCTCCAAT GCAGATGAGAGGCTGGAAGCCGTCCATGAAGTGCTGATGCTGCTGCCTCCTGCCCACTATGAAACCCTCC GGTACCTAATGATCCACCTCAAAAAGGTTACTATGAATGAAAAAGACAATTTCATGAATGCAGAAAATCT GGGGATCGTGTTTGGGCCCACTCTGATGAGGCCCCCTGAGGACAGCACCCTGACCACCCTGCATGATATG CGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAACGAAGACGTTTTATTCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001293078 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001293078.1, NP_001280007.1 |
RefSeq Size | 2703 bp |
RefSeq ORF | 687 bp |
Locus ID | 1124 |
UniProt ID | P52757 |
Gene Summary | This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that contains a phorbol-ester/diacylglycerol (DAG)-type zinc finger, a Rho-GAP domain, and an SH2 domain. The encoded protein translocates from the cytosol to the Golgi apparatus membrane upon binding by diacylglycerol (DAG). Activity of this protein is important in cell proliferation and migration, and expression changes in this gene have been detected in cancers. A mutation in this gene has also been associated with schizophrenia in men. Alternative transcript splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, May 2014] Transcript Variant: This variant (11, also known as B1-CHNdel ex9,11) lacks two alternate in-frame exons, compared to variant 1. The encoded isoform (11) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Chimaerin 2产品
Customer
Reviews
Loading...