PRMT2 (NM_001286678) Human Untagged Clone
CAT#: SC334622
PRMT2 (untagged) - Human protein arginine methyltransferase 2 (PRMT2), transcript variant 8
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
PRMT2 mouse monoclonal antibody, clone OTI3A3 (formerly 3A3)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HRMT1L1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286678, the custom clone sequence may differ by one or more nucleotides
ATGGCAACATCAGGTGACTGTCCCAGAAGTGAATCGCAGGGAGAAGAGCCTGCTGAGTGCAGTGAGGCCG GTCTCCTGCAGGAGGGAGTACAGCCAGAGGAGTTTGTGGCCATCGCGGACTACGCTGCCACCGATGAGAC CCAGCTCAGTTTTTTGAGAGGAGAAAAAATTCTTATCCTGAGACAAACCACTGCAGATTGGTGGTGGGGT GAGCGTGCGGGCTGCTGTGGGTACATTCCGGCAAACCATGTGGGGAAGCACGTGGATGAGTACGACCCCG AGGACACGTGGCAGGATGAAGAGTACTTCGGCAGCTATGGAACTCTGAAACTCCACTTGGAGATGTTGGC AGACCAGCCACGAACAACTAAATACCACAGTGTCATCCTGCAGAATAAAGAATCCCTGACGGATAAAGTC ATCCTGGACGTGGGCTGTGGGACTGGGATCATCAGTCTCTTCTGTGCACACTATGCGCGGCCTAGAGCGG TGTACGCGGTGGAGGCCAGTGAGATGGCACAGCACACGGGGCAGCTGGTCCTGCAGAACGGCTTTGCTGA CATCATCACCGTGTACCAGCAGAAGGTGGAGGATGTGGTGCTGCCCGAGAAGGTGGACGTGCTGGTGTCT GAGTGGATGGGGACCTGCCTGCTGGTTGGAGAAAAAGTCTTCCCCATCTGGAGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286678 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286678.1, NP_001273607.1 |
RefSeq Size | 1722 bp |
RefSeq ORF | 687 bp |
Locus ID | 3275 |
UniProt ID | P55345 |
Protein Families | Druggable Genome |
Gene Summary | Arginine methyltransferase that methylates the guanidino nitrogens of arginyl residues in proteins such as STAT3, FBL, histone H4. Acts as a coactivator (with NCOA2) of the androgen receptor (AR)-mediated transactivation. Acts as a coactivator (with estrogen) of estrogen receptor (ER)-mediated transactivation. Enhances PGR, PPARG, RARA-mediated transactivation. May inhibit NF-kappa-B transcription and promote apoptosis. Represses E2F1 transcriptional activity (in a RB1-dependent manner). May be involved in growth regulation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (8) differs in the 5' UTR and lacks 4 consecutive exons in the 3' coding region compared to variant 1. However, it maintains the reading frame and encodes a shorter isoform (7) lacking an internal protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...