TPD52L2 (NM_001243895) Human Untagged Clone
CAT#: SC334581
TPD52L2 (untagged) - Human tumor protein D52-like 2 (TPD52L2), transcript variant 10
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | D54; TPD54 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001243895, the custom clone sequence may differ by one or more nucleotides
ATGGACTCCGCCGGCCAAGATATCAACCTGAATTCTCCTAACAAAGGTCTGCTGTCTGACTCCATGACGG ATGTTCCTGTCGACACAGGTGTGGCTGCCCGGACTCCTGCTGTTGAGGGTCTGACAGAGGCTGAGGAGGA GGAGCTCAGGGCTGAGCTTACCAAGGTGGAAGAGGAAATTGTCACTCTGCGCCAGGTCCTGGCAGCCAAG GAGAGGCACTGTGGAGAGCTCAAGAGGAGGCTGGGCCTCTCCACCCTGGGGGAGCTGAAACAGAACCTGT CCAGGAGCTGGCATGACGTGCAGGTCTCTAGCGCCTATGTGAAAACTTCTGAGAAACTTGGAGAGTGGAA TGAGAAAGTGACCCAGTCAGACCTCTACAAGAAGACTCAGGAAACTCTTTCACAGGCAGGACAGAAGACT TCAGCTGCCCTGTCCACAGTGGGCTCTGCCATCAGCAGGAAGCTTGGAGACATGAGTCTAAGGTTGTGGG TGACAGAGAGAACGGCAGTGACAACCTCCCTTCCTCAGCGGGGAGTGGTGACAAGCCCCTGTCGGATCCC GCACCTTTCTAAGCCTGTGGTTGCTTCACCCGCTGCAGAGCACACGCAACCCAGCCTCAGCATCACAGCC GCAGCTCTGTTCAGCGGAGCAGCCAGCCAGGGCGGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243895 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001243895.1, NP_001230824.1 |
RefSeq Size | 2310 bp |
RefSeq ORF | 669 bp |
Locus ID | 7165 |
Gene Summary | This gene encodes a member of the tumor protein D52-like family. These proteins are characterized by an N-terminal coiled-coil motif that is used to form homo- and heteromeric complexes with other tumor protein D52-like proteins. Expression of this gene may be a marker for breast cancer and acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 12. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (10) lacks three consecutive exons in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (j) is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它TPD52L2产品
Customer
Reviews
Loading...