MFF (NM_001277067) Human Untagged Clone

CAT#: SC334578

MFF (untagged) - Human mitochondrial fission factor (MFF), transcript variant 8



  "NM_001277067" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-MFF Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C2orf33; EMPF2; GL004
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001277067, the custom clone sequence may differ by one or more nucleotides


ATGCAAGTTCCGGAGAGGATTGTTGTAGCAGGAAATAATGAAGATGTTTCATTTTCAAGACCAGCAGATC
TTGACCTTATTCAGTCAACTCCCTTTAAACCCCTGGCACTGAAAACACCACCTCGTGTACTTACGCTGAG
TGAAAGACCACTAGATTTTCTGGATTTAGAAAGACCTCCTACAACCCCTCAAAATGAAGAAATCCGAGCA
GTTGGCAGACTAAAAAGAGAGCGGTCTATGAGTGAAAATGCTGTTCGCCAAAATGGACAGCTGGTCAGAA
ATGATTCTCTTGTGACACCATCGCCACAACAGGCTCGGGTCTGTCCTCCCCATATGTTACCTGAAGATGG
AGCTAATCTTTCCTCTGCTCGTGGCATTTTGTCGCTTATCCAGTCTTCTACTCGTAGGGCATACCAGCAG
ATCTTGGATGTGCTGGATGAAAATCGCAGGTATGGCATTTCAAATATAGATACAACCATTGAAGGAACGT
CAGATGACCTGACTGTTGTAGATGCAGCTTCACTAAGACGACAGATAATCAAACTAAATAGACGTCTACA
ACTTCTGGAAGAGGAGAACAAAGAACGTGCTAAAAGAGAAATGGTCATGTATTCAATTACTGTAGCTTTC
TGGCTGCTTAATAGCTGGCTCTGGTTTCGCCGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001277067
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001277067.1, NP_001263996.1
RefSeq Size 1710 bp
RefSeq ORF 666 bp
Locus ID 56947
UniProt ID Q9GZY8
Protein Families Transmembrane
Gene Summary This is a nuclear gene encoding a protein that functions in mitochondrial and peroxisomal fission. The encoded protein recruits dynamin-1-like protein (DNM1L) to mitochondria. There are multiple pseudogenes for this gene on chromosomes 1, 5, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (8) differs in the 5' UTR, lacks a portion of the 5' coding region and lacks two in-frame exons, compared to variant 1. It initiates translation at a downstream in-frame start codon. The encoded isoform (f) is shorter and has a shorter N-terminus than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...