PDCD2 (NM_001199461) Human Untagged Clone
CAT#: SC334571
PDCD2 (untagged) - Human programmed cell death 2 (PDCD2), transcript variant 3
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RP8; ZMYND7 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001199461, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCCGCCGGGGCCAGGCCTGTGGAGCTGGGCTTCGCCGAGTCGGCGCCGGCGTGGCGACTGCGCA GCGAGCAGTTCCCCAGCAAGGTGGGCGGGCGGCCGGCATGGCTGGGCGCGGCCGGGCTGCCGGGGCCCCA GGCCCTGGCCTGCGAGCTGTGCGGCCGCCCGCTCTCCTTCCTGCTGCAGGTGTATGCGCCGCTGCCTGGC CGCCCGGACGCCTTCCACCGCTGCATCTTCCTCTTCTGCTGCCGCGAGCAGCCGTGCTGTGCCGGCCTGC GAGTTTTTAGGAATCAACTACCCAGGAAAAACGATTTTTACTCATATGAGCCACCTTCTGAGAATCCTCC CCCAGAAACAGGAGAATCAGTGTGTCTCCAGCTTAAGTCTGGTGCTCATCTCTGCAGGGTTTGTGGCTGT TTAGGCCCCAAAACGTGCTCCAGATGCCACAAAGCATATTACTGCAGCAAGGAGCATCAGACCCTAGACT GGAGATTGGGACATAAGCAGGCTTGTGCACAACCAGATCATCTGGACCATATAATTCCAGACCACAACTT CCTTTTTCCAGAATTTGAAATTGTAATAGAAACAGAAGATGAGATTATGCCTGAGGTTGTGGAAAAGGAA GATTACTCAGAGATTATAGGGAGCATGGGGATATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199461 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001199461.1, NP_001186390.1 |
RefSeq Size | 1307 bp |
RefSeq ORF | 666 bp |
Locus ID | 5134 |
Gene Summary | This gene encodes a nuclear protein expressed in a variety of tissues. Expression of this gene has been shown to be repressed by B-cell CLL/lymphoma 6 (BCL6), a transcriptional repressor required for lymph node germinal center development, suggesting that BCL6 regulates apoptosis by its effects on this protein. Alternative splicing results in multiple transcript variants and pseudogenes have been identified on chromosomes 9 and 12. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (3) differs in the 3' coding region and UTR, compared to variant 1. The resulting protein (isoform 3) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...