TSPAN16 (NM_001282510) Human Untagged Clone
CAT#: SC334558
TSPAN16 (untagged) - Human tetraspanin 16 (TSPAN16), transcript variant 3
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (3)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TM-8; TM4-B; TM4SF16 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282510, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAAATCCACACTCCGTATTCTTCCTTGAAGAAACTGTTATCTTTACTCAATGGCTTCGTGGCTG TGTCTGGCATCATCCTAGTTGGCCTGGGCATTGGTGGTAAATGTGGAGGGGCCTCTCTGACGAATGTCCT CGGGCTGTCCTCCGCATACCTCCTTCACGTTGGCAACCTGTGCCTGGTGATGGGATGCATCACGGTACTG CTTGGCTGTGCCGGGTGGTATGGAGCGACTAAAGAGAGCAGAGGCACGCTCTTGTTTGTTGGAGATGTGG CCTTGGAACACACCTTCGTGACCCTGAGGAAGAATTACAGAGGTTACAACGAGCCAGACGACTATTCTAC ACAGTGGAACTTGGTCATGGAGAAGCTAAAGTGCTGTGGGGTGAATAACTACACAGATTTTTCTGGCTCT TCCTTCGAAATGACAACGGGCCACACCTACCCCAGGAGTTGCTGTAAATCCATCGGAAGTGTGTCCTGTG ACGGACGCGATGTGTCTCCAAACGTCATCCACCAGAAGGGCTGTTTCCATAAACTCCTAAAAATCACCAA GACTCAGAGCTTCACCCTGAGTGGGAGCTCTCTGGGAGCTGCAGTGATACAGTTGCCAGGAATTCTTGCC ACTTTGCTGCTGTTTATCAAGCTGGGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282510 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282510.1, NP_001269439.1 |
RefSeq Size | 970 bp |
RefSeq ORF | 660 bp |
Locus ID | 26526 |
UniProt ID | Q9UKR8 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein might couple to signal transduction pathways and possibly modulate cellular activation and adhesion in haemopoietic and neural tissue. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (3) differs in the 3' UTR and coding sequence and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus and lacks an alternate internal segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它TSPAN16产品
Customer
Reviews
Loading...