SLC35A2 (NM_001282648) Human Untagged Clone
CAT#: SC334552
SLC35A2 (untagged) - Human solute carrier family 35 (UDP-galactose transporter), member A2 (SLC35A2), transcript variant 5
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CDG2M; CDGX; UDP-Gal-Tr; UGALT; UGAT; UGT; UGT1; UGT2; UGTL |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282648, the custom clone sequence may differ by one or more nucleotides
ATGAAGCTCTGTAGGGATGCTCACAGGCGCCTGAAGTACATATCCCTAGCTGTGCTGGTGGTCCAGAATG CCTCCCTCATCCTCAGCATCCGCTACGCCCGCACGTTGCCAGGGGACCGCTTCTTTGCCACCACTGCTGT GGTCATGGCGGAAGTGCTCAAAGGTCTCACCTGCCTGCTGCTGCTCTTCGCACAGAAGAGGGGTAACGTG AAGCACCTGGTTCTCTTCCTCCATGAGGCTGTCCTGGTGCAGTATGTGGACACGCTCAAGCTCGCAGTGC CCTCTCTCATCTACACCTTGCAGAATAACCTCCAGTATGTTGCCATCTCTAACCTACCAGCTGCCACTTT CCAGCCTTCCCCGAGGTGCAGCCAAAGCCATAGCCTCTGCCTCTGCCTCCGCCTCCGGGCCCTGCGTTCA CCAGCAGCCTCCCGGGCAGCCACCACCACCGCAGCTGTCTTCCCACCGTGGAGACCTCATCACGGAGCCC TTTCTGCCAAAGTCAGTGCTGGTGAAGTGAGGGCTGGCAGCAATGGGGGGACACAAGGGAGGGGGACTGG GGTGGAGGGTGTTGGGCATCTGCAGGACCCAAGTCGCCACCCTCCGGGGCCTGGCTCCTCTGGGTTTGGG AGATGGTCTTTTCTCCCAGGTCACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282648 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282648.1, NP_001269577.1 |
RefSeq Size | 1716 bp |
RefSeq ORF | 657 bp |
Locus ID | 7355 |
UniProt ID | P78381 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a member of the nucleotide-sugar transporter family. The encoded protein is a multi-pass membrane protein. It transports UDP-galactose from the cytosol into Golgi vesicles, where it serves as a glycosyl donor for the generation of glycans. Mutations in this gene cause congenital disorder of glycosylation type IIm (CDG2M). Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (5) lacks a portion of the 5' coding region, initiates translation at an alternate upstream start codon, and differs in the 3' exon structure, compared to variant 1. The encoded isoform (e) is shorter and has distinct N- and C-termini, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236658 | SLC35A2 (myc-DDK-tagged) - Human solute carrier family 35 (UDP-galactose transporter), member A2 (SLC35A2), transcript variant 5 |
CNY 2640.00 |
|
RG236658 | SLC35A2 (tGFP-tagged) - Human solute carrier family 35 (UDP-galactose transporter), member A2 (SLC35A2), transcript variant 5 |
CNY 4370.00 |
其它SLC35A2产品