NAA40 (NM_001300800) Human Untagged Clone
CAT#: SC334531
NAA40 (untagged) - Human N(alpha)-acetyltransferase 40, NatD catalytic subunit (NAA40), transcript variant 2
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hNatD; NAT11; NatD; PATT1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300800, the custom clone sequence may differ by one or more nucleotides
ATGGATGCCGTTTGTGCCAAAGTGGACGCTGCCAACAGGCTTGGAGACCCTCTGGAGGCTTTCCCAGTGT TCAAGAAATATGATAGAAACGGGTTGAATGTCTCCATTGAATGTAAGCGAGTGTCTGGACTGGAGCCAGC CACCGTGGATTGGGCCTTCGACCTGACCAAAACGAATATGCAAACCATGTATGAGCAGAGCGAGTGGGGC TGGAAGGACCGAGAGAAACGGGAGGAAATGACAGATGACCGAGCCTGGTACCTCATCGCGTGGGAAAACA GCTCCGTCCCTGTTGCCTTTTCTCACTTCCGGTTTGACGTGGAGTGTGGGGATGAAGTCCTGTACTGCTA TGAAGTGCAGTTGGAAAGCAAGGTGCGGCGGAAAGGCCTGGGGAAGTTCCTCATACAGATCCTGCAGCTC ATGGCCAACAGCACACAGATGAAGAAGGTTATGTTAACAGTATTTAAACACAATCATGGTGCCTACCAGT TCTTCAGAGAAGCGTTGCAATTTGAAATTGATGACTCTTCCCCCAGCATGTCCGGTTGCTGTGGGGAGGA TTGCTCCTATGAGATCCTGAGCCGGAGGACCAAGTTTGGGGACAGCCATCACTCCCACGCGGGTGGGCAC TGTGGTGGCTGCTGCCACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300800 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001300800.1, NP_001287729.1 |
RefSeq Size | 3752 bp |
RefSeq ORF | 651 bp |
Locus ID | 79829 |
UniProt ID | Q86UY6 |
Gene Summary | N-alpha-acetyltransferase that specifically mediates the acetylation of the N-terminal residues of histones H4 and H2A (PubMed:21935442, PubMed:25619998). In contrast to other N-alpha-acetyltransferase, has a very specific selectivity for histones H4 and H2A N-terminus and specifically recognizes the 'Ser-Gly-Arg-Gly sequence' (PubMed:21935442, PubMed:25619998). Acts as a negative regulator of apoptosis (PubMed:26666750). May play a role in hepatic lipid metabolism (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate exon in place of the first exon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...