VPS29 (NM_001282150) Human Untagged Clone

CAT#: SC334516

VPS29 (untagged) - Human vacuolar protein sorting 29 homolog (S. cerevisiae) (VPS29), transcript variant 3



  "NM_001282150" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
VPS29 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DC7; DC15; PEP11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282150, the custom clone sequence may differ by one or more nucleotides


ATGAGCAGGTGTGCTCTCAGAGGGCGGGATTTGGCGCTTGCAATTGCTGGAACTGTTTCTTTCCACGGGT
TGCTACGCCTCTTTAGGGCTGGGCACAGATTGGTGTTGGTATTAGGAGATCTGCACATCCCACACCGGTG
CAACAGTTTGCCAGCTAAATTCAAAAAACTCCTGGTGCCAGGAAAAATTCAGCACATTCTCTGCACAGGA
AACCTTTGCACCAAAGAGAGTTATGACTATCTCAAGACTCTGGCTGGTGATGTTCATATTGTGAGAGGAG
ACTTCGATGAGAATCTGAATTATCCAGAACAGAAAGTTGTGACTGTTGGACAGTTCAAAATTGGTCTGAT
CCATGGACATCAAGTTATTCCATGGGGAGATATGGCCAGCTTAGCCCTGTTGCAGAGGCAATTTGATGTG
GACATTCTTATCTCGGGACACACACACAAATTTGAAGCATTTGAGCATGAAAATAAATTCTACATTAATC
CAGGTTCTGCCACTGGGGCATATAATGCCTTGGAAACAAACATTATTCCATCATTTGTGTTGATGGATAT
CCAGGCTTCTACAGTGGTCACCTATGTGTATCAGCTAATTGGAGATGATGTGAAAGTAGAACGAATCGAA
TACAAAAAACCTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001282150
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282150.1, NP_001269079.1
RefSeq Size 1296 bp
RefSeq ORF 645 bp
Locus ID 51699
Gene Summary This gene belongs to a group of vacuolar protein sorting (VPS) genes that, when functionally impaired, disrupt the efficient delivery of vacuolar hydrolases. The protein encoded by this gene is a component of a large multimeric complex, termed the retromer complex, which is involved in retrograde transport of proteins from endosomes to the trans-Golgi network. This VPS protein may be involved in the formation of the inner shell of the retromer coat for retrograde vesicles leaving the prevacuolar compartment. Alternative splice variants encoding different isoforms and representing non-protein coding transcripts have been found for this gene. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (3) represents the longest transcript and encodes the longest isoform (3).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...