Proteasome 20S beta 6 (PSMB6) (NM_001270481) Human Untagged Clone

CAT#: SC334506

PSMB6 (untagged) - Human proteasome (prosome, macropain) subunit, beta type, 6 (PSMB6), transcript variant 2



  "NM_001270481" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PSMB6 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DELTA; LMPY; Y
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001270481, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCTTGGGGGCCGGAGGCGTTCACTC
CAGACTGGGAAAGCCGAGAAGTTTCCACTGGGACCACTATCATGGCCGTGCAGTTTGACGGGGGCGTGGT
TCTGGGGGCGGACTCCAGAACAACCACTGGGTCCTACATCGCCAATCGAGTGACTGACAAGCTGACACCT
ATTCACGACCGCATTTTCTGCTGTCGCTCAGGCTCAGCTGCTGATACCCAGGCAGTAGCTGATGCTGTCA
CCTACCAGCTCGGTTTCCACAGCATTGAACTGAATGAGCCTCCACTGGTCCACACAGCAGCCAGCCTCTT
TAAGGAGATGTGTTACCGATACCGGGAAGACCTGATGGCGGGAATCATCATCGCAGGCTGGGACCCTCAA
GAAGGAGGGCAGGTGTACTCAGTGCCTATGGGGGGTATGATGGTAAGGCAGTCCTTTGCCATTGGAGGCT
CCGGGAGCTCCTACATCTATGGCTATGTTGATGCTACCTACCGGGAAGGCATGACCAAGGAAGAGTGTCT
GCAATTCACTGCCAATGCTTTCTTCTTTTATCCACAGCTCTCGCTTTGGCCATGGAGCGGGATGGCTCCA
GTGGAGGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001270481
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270481.1, NP_001257410.1
RefSeq Size 889 bp
RefSeq ORF 642 bp
Locus ID 5694
Protein Families Druggable Genome, Protease
Protein Pathways Proteasome
Gene Summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. The encoded protein is a member of the proteasome B-type family, also known as the T1B family, and is a 20S core beta subunit in the proteasome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. It is not known whether this isoform (2) is proteolytically processed in the same manner as isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...