NQO1 (NM_001286137) Human Untagged Clone
CAT#: SC334423
NQO1 (untagged) - Human NAD(P)H dehydrogenase, quinone 1 (NQO1), transcript variant 4
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DHQU; DIA4; DTD; NMOR1; NMORI; QR1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286137, the custom clone sequence may differ by one or more nucleotides
ATGGTCGGCAGAAGAGCACTGATCGTACTGGCTCACTCAGAGAGGACGTCCTTCAACTATGCCATGAAGG AGGCTGCTGCAGCGGCTTTGAAGAAGAAAGGATGGGAGGTGGTGGAGTCGGACCTCTATGCCATGAACTT CAATCCCATCATTTCCAGAAAGGACATCACAGGTAAACTGAAGGACCCTGCGAACTTTCAGTATCCTGCC GAGTCTGTTCTGGCTTATAAAGAAGGCCATCTGAGCCCAGATATTGTGGCTGAACAAAAGAAGCTGGAAG CCGCAGACCTTGTGATATTCCAGAGTGGCATTCTGCATTTCTGTGGCTTCCAAGTCTTAGAACCTCAACT GACATATAGCATTGGGCACACTCCAGCAGACGCCCGAATTCAAATCCTGGAAGGATGGAAGAAACGCCTG GAGAATATTTGGGATGAGACACCACTGTATTTTGCTCCAAGCAGCCTCTTTGACCTAAACTTCCAGGCAG GATTCTTAATGAAAAAAGAGGTACAGGATGAGGAGAAAAACAAGAAATTTGGCCTTTCTGTGGGCCATCA CTTGGGCAAGTCCATCCCAACTGACAACCAGATCAAAGCTAGAAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286137 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286137.1, NP_001273066.1 |
RefSeq Size | 2423 bp |
RefSeq ORF | 609 bp |
Locus ID | 1728 |
Protein Families | Druggable Genome |
Gene Summary | This gene is a member of the NAD(P)H dehydrogenase (quinone) family and encodes a cytoplasmic 2-electron reductase. This FAD-binding protein forms homodimers and reduces quinones to hydroquinones. This protein's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in this gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Altered expression of this protein has been seen in many tumors and is also associated with Alzheimer's disease (AD). Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) lacks two alternate in-frame exons compared to variant 1. The resulting protein (isoform d) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...