ARL4C (NM_001282431) Human Untagged Clone

CAT#: SC334418

ARL4C (untagged) - Human ADP-ribosylation factor-like 4C (ARL4C), transcript variant 1



  "NM_001282431" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-ARL4C Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARL7; LAK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282431, the custom clone sequence may differ by one or more nucleotides


ATGGGCAACATCTCCTCTAACATCTCGGCCTTCCAGTCCCTGCATATCGTCATGTTGGGCTTGGACTCGG
CCGGCAAGACCACGGTGCTCTACCGGCTCAAGTTCAACGAGTTCGTGAACACGGTGCCCACCATCGGCTT
CAACACCGAGAAGATCAAGCTGAGCAACGGCACGGCCAAGGGCATCAGCTGCCACTTCTGGGACGTGGGC
GGCCAGGAGAAGCTGCGGCCGCTGTGGAAGTCCTACAGCCGCTGCACGGACGGCATCATCTACGTGGTGG
ACTCGGTGGACGTGGACCGGCTGGAGGAGGCCAAGACGGAGCTGCACAAGGTGACCAAGTTCGCCGAGAA
CCAGGGCACGCCGCTGCTGGTCATCGCCAACAAGCAGGACCTGCCCAAGTCGCTGCCGGTGGCAGAGATT
GAGAAGCAGCTGGCGCTGCACGAGCTTATCCCGGCCACCACCTATCACGTCCAGCCGGCGTGCGCCATCA
TCGGCGAGGGCCTCACCGAGGGCATGGACAAGCTCTATGAGATGATCCTGAAACGCAGGAAGTCCCTCAA
GCAGAAGAAGAAGCGGACTGGTGACTTAAGGAGCTGCGAAGTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282431
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282431.1, NP_001269360.1
RefSeq Size 3838 bp
RefSeq ORF 606 bp
Locus ID 10123
UniProt ID P56559
Gene Summary ADP-ribosylation factor-like 4C is a member of the ADP-ribosylation factor family of GTP-binding proteins. ARL4C is closely similar to ARL4A and ARL4D and each has a nuclear localization signal and an unusually high guanine nucleotide exchange rate. This protein may play a role in cholesterol transport. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...