PRH1 (NM_001291315) Human Untagged Clone
CAT#: SC334413
PRH1 (untagged) - Human proline-rich protein HaeIII subfamily 1 (PRH1), transcript variant 2
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Db-s; PA; PIF-S; Pr1/Pr2; PRH2; PRP-1/PRP-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001291315, the custom clone sequence may differ by one or more nucleotides
ATGTGGAGGGGAATAGACTCCATCTATCCATATGAGCTGCTGCAGAAGAATATTTTGCCTGCTGGAACCT GCTGTATCTACTCAAGAGTGGAAGTTTTCACAGATGTCAGCCAGGAAGATGTTCCCCTCGTAATATCAGA TGGAGGAGACTCTGAGCAGTTCCTAGATGAGGAGCGTCAGGGACCACCTTTGGGAGGACAGCAATCTCAA CCCTCTGCTGGTGATGGGAACCAGGATGATGGCCCTCAGCAGGGACCACCCCAACAAGGAGGCCAGCAGC AACAAGGTCCACCACCTCCTCAGGGAAAGCCACAAGGACCACCCCAACAAGGAGGCCAGCAGCAACAAGG TCCACCACCTCCTCAGGGAAAGCCACAAGGACCACCCCAACAGGGAGGCCATCCCCCTCCTCCTCAAGGA AGGCCACAAGGACCACCCCAACAGGGAGGCCATCCCCGTCCTCCTCGAGGAAGGCCACAAGGACCACCCC AACAGGGAGGCCATCAGCAAGGTCCTCCCCCACCTCCTCCTGGAAAGCCCCAGGGACCACCTCCCCAAGG GGGCCGCCCACAAGGACCTCCACAGGGGCAGTCTCCTCAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291315 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001291315.1, NP_001278244.1 |
RefSeq Size | 1052 bp |
RefSeq ORF | 603 bp |
Locus ID | 5554 |
UniProt ID | P02810 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the heterogeneous family of proline-rich salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature isoforms before secretion from the parotid and submandibular/sublingual glands. Multiple distinct alleles of this locus including the parotid isoelectric-focusing variant slow (PIF-s), the parotid acidic protein (Pa), and the double band slow (Db-s) isoforms have been characterized. The reference genome encodes the Db-s allele. Certain alleles of this gene are associated with susceptibility to dental caries. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. Co-transcription of this gene with adjacent genes has been observed. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (2) differs in the 5' coding region and uses an alternate start codon, compared to variant 1. The encoded isoform (b) has a longer and distinct N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...