DOK5 (NM_177959) Human Untagged Clone

CAT#: SC334385

DOK5 (untagged) - Human docking protein 5 (DOK5), transcript variant 2



  "NM_177959" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-DOK5 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C20orf180; IRS-6; IRS6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_177959, the custom clone sequence may differ by one or more nucleotides


ATGGAGTGTGTAGGAACACGGATCAATGACATCAGCCTTGGAGAGCCTGACTTACTGGCCACTGGGGTTG
AGAGAGAACAGAGTGAGAGATTCAATGTGTATTTGATGCCATCTCCTAACTTAGATGTACATGGCGAATG
TGCCTTGCAGATTACATATGAGTATATCTGTCTTTGGGACGTCCAGAATCCCAGAGTCAAACTCATCTCT
TGGCCGCTAAGCGCCCTGCGGCGGTATGGACGTGATACTACGTGGTTCACTTTTGAGGCAGGGAGGATGT
GTGAGACTGGTGAAGGGCTGTTTATCTTTCAGACCCGAGACGGGGAGGCCATCTATCAGAAAGTCCACTC
TGCTGCCTTGGCCATAGCCGAGCAGCACGAGCGCTTGCTACAGAGTGTGAAAAACTCGATGCTCCAGATG
AAGATGAGTGAGCGGGCCGCCTCGCTGAGCACCATGGTGCCCCTGCCTCGCAGCGCCTACTGGCAGCACA
TCACACGGCAGCACAGCACGGGACAGCTCTACCGCTTGCAAGATGTTTCCAGCCCTCTGAAGCTTCATCG
AACAGAGACTTTTCCAGCCTACAGATCTGAGCACTGA


Restriction Sites SgfI-MluI     
ACCN NM_177959
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_177959.2, NP_808874.1
RefSeq Size 1734 bp
RefSeq ORF 597 bp
Locus ID 55816
UniProt ID Q9P104
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene is a member of the DOK family of membrane proteins, which are adapter proteins involved in signal transduction. The encoded protein interacts with phosphorylated receptor tyrosine kinases to mediate neurite outgrowth and activation of the MAP kinase pathway. Unlike other DOK family proteins, this protein does not interact with RASGAP. This protein is up-regulated in patients with systemic sclerosis and is associated with fibrosis induced by insulin-like growth factor binding protein 5. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon, and it thus differs in its 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...