WSB2 (NM_001278558) Human Untagged Clone
CAT#: SC334362
WSB2 (untagged) - Human WD repeat and SOCS box containing 2 (WSB2), transcript variant 3
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SBA2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278558, the custom clone sequence may differ by one or more nucleotides
ATGCTGTGCTCTGCAGCTGGAGAGAAGTCGGTCTTTCTATGGAGCATGAGGTCCTACACGTTAATTCGGA AGCTAGAGGGCCATCAAAGCAGTGTTGTCTCTTGTGACTTCTCCCCCGACTCTGCCCTGCTTGTCACGGC TTCTTACGATACCAATGTGATTATGTGGGACCCCTACACCGGCGAAAGGCTGAGGTCACTCCACCACACC CAGGTTGACCCCGCCATGGATGACAGTGACGTCCACATTAGCTCACTGAGATCTGTGTGCTTCTCTCCAG AAGGCTTGTACCTTGCCACGGTGGCAGATGACAGACTCCTCAGGATCTGGGCCCTGGAACTGAAAACTCC CATTGCATTTGCTCCTATGACCAATGGGCTTTGCTGCACATTTTTTCCACATGGTGGAGTCATTGCCACA GGGACAAGAGATGGCCACGTCCAGTTCTGGACAGCTCCTAGGGTCCTGTCCTCACTGAAGCACTTATGCC GGAAAGCCCTTCGAAGTTTCCTAACAACTTACCAAGTCCTAGCACTGCCAATCCCCAAGAAAATGAAAGA GTTCCTCACATACAGGACTTTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278558 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278558.1, NP_001265487.1 |
RefSeq Size | 2521 bp |
RefSeq ORF | 585 bp |
Locus ID | 55884 |
UniProt ID | Q9NYS7 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the WD-protein subfamily. The encoded protein contains five WD-repeats spanning most of the protein and an SOCS box in the C-terminus. The SOCS box may act as a bridge between specific substrate-binding domains and E3 ubiquitin protein ligases. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence and lacks two internal exons compared to variant 1. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...