OTUD6B (NM_001286745) Human Untagged Clone
CAT#: SC334349
OTUD6B (untagged) - Human OTU domain containing 6B (OTUD6B), transcript variant 2
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CGI-77; DUBA-5; DUBA5; IDDFSDA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286745, the custom clone sequence may differ by one or more nucleotides
ATGATATCTAAGGAAAAGAAAGCTGCATTGGAAAAGGAGCGAGAAGAACGGATAGCTGAAGCTGAAATTG AAAACTTAACAGGAGCCAGACATATGGAAAGTGAGAAACTTGCTCAAATATTGGCAGCTAGACAGTTAGA AATTAAACAGATTCCATCTGATGGCCACTGTATGTATAAAGCCATTGAAGATCAACTGAAAGAAAAGGAT TGTGCTCTGACTGTGGTTGCCTTGAGAAGTCAGACCGCTGAGTATATGCAAAGCCATGTGGAAGACTTTC TGCCATTTTTAACAAACCCTAATACAGGAGATATGTATACTCCAGAAGAATTTCAGAAGTACTGTGAAGA TATTGTAAACACAGCTGCATGGGGAGGTCAGCTTGAGCTAAGAGCTCTGTCTCACATTTTACAAACACCA ATAGAGATAATACAGGCAGATTCTCCTCCCATTATAGTTGGTGAAGAATATTCAAAAAAACCACTAATAC TTGTATATATGAGACATGCATATGGCTTAGGAGAACATTATAATTCGGTTACACGGTTGGTAAACATAGT TACTGAAAATTGCAGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286745 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286745.1, NP_001273674.1 |
RefSeq Size | 3452 bp |
RefSeq ORF | 579 bp |
Locus ID | 51633 |
UniProt ID | Q8N6M0 |
Protein Families | Protease |
Gene Summary | This gene encodes a member of the ovarian tumor domain (OTU)-containing subfamily of deubiquitinating enzymes. Deubiquitinating enzymes are primarily involved in removing ubiquitin from proteins targeted for degradation. This protein may function as a negative regulator of the cell cycle in B cells. [provided by RefSeq, Nov 2013] Transcript Variant: This variant (2) contains an alternate exon in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...