EIF3K (NM_001300992) Human Untagged Clone
CAT#: SC334348
EIF3K (untagged) - Human eukaryotic translation initiation factor 3, subunit K (EIF3K), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARG134; EIF3-p28; EIF3S12; HSPC029; M9; MSTP001; PLAC-24; PLAC24; PRO1474; PTD001 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300992, the custom clone sequence may differ by one or more nucleotides
ATGGCGATGTTTGAGCAGATGAGAGCCAACGTGGGCAAGTTGCTCAAGGGTATCGACAGGTACAATCCTG AGAACCTGGCCACCCTGGAGCGCTATGTAGAGACGCAGGCCAAGGAAAATGCCTATGATCTGGAAGCCAA CCTGGCTGTCCTGAAGCTGTACCAGTTCAACCCAGCCTTCTTTCAGACCACGGTCACCGCCCAGATCCTG CTGAAGGCCCTCACCAACTTGCCGCACACAGACTTCACCCTGTGCAAGTGCATGATCGACCAGGCACATC AAGAAGAACGGCCAATCCGACAGATTTTGTACCTCGGGGACCTGCTGGAGACCTGCCATTTCCAGGCCTT CTGGCAAGCCCTGGATGAAAACATGGACCTCTTGGAAGGTATAACTGGCTTTGAAGACTCTGTCCGAAAG TACAGCCAGCTAAAGGTGTGGATGAGCAAATACGGCTGGAGTGCCGACGAGTCGGGGCAGATCTTCATCT GTAGCCAAGAAGAGAGCATTAAACCCAAGAACATTGTGGAGAAGATTGACTTTGACAGTGTGTCCAGCAT CATGGCCTCCTCCCAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300992 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001300992.1, NP_001287921.1 |
RefSeq Size | 820 bp |
RefSeq ORF | 579 bp |
Locus ID | 27335 |
Gene Summary | The 700-kD eukaryotic translation initiation factor-3 (eIF3) is the largest eIF and contains at least 12 subunits, including EIF2S12. eIF3 plays an essential role in translation by binding directly to the 40S ribosomal subunit and promoting formation of the 40S preinitiation complex (Mayeur et al., 2003 [PubMed 14519125]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. It encodes isoform 2, which lacks an internal segment and is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236454 | EIF3K (myc-DDK-tagged) - Human eukaryotic translation initiation factor 3, subunit K (EIF3K), transcript variant 2 |
CNY 3990.00 |
|
RG236454 | EIF3K (tGFP-tagged) - Human eukaryotic translation initiation factor 3, subunit K (EIF3K), transcript variant 2 |
CNY 4240.00 |