EIF3K (NM_001300992) Human Untagged Clone

CAT#: SC334348

EIF3K (untagged) - Human eukaryotic translation initiation factor 3, subunit K (EIF3K), transcript variant 2



  "NM_001300992" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


EIF3K rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARG134; EIF3-p28; EIF3S12; HSPC029; M9; MSTP001; PLAC-24; PLAC24; PRO1474; PTD001
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300992, the custom clone sequence may differ by one or more nucleotides


ATGGCGATGTTTGAGCAGATGAGAGCCAACGTGGGCAAGTTGCTCAAGGGTATCGACAGGTACAATCCTG
AGAACCTGGCCACCCTGGAGCGCTATGTAGAGACGCAGGCCAAGGAAAATGCCTATGATCTGGAAGCCAA
CCTGGCTGTCCTGAAGCTGTACCAGTTCAACCCAGCCTTCTTTCAGACCACGGTCACCGCCCAGATCCTG
CTGAAGGCCCTCACCAACTTGCCGCACACAGACTTCACCCTGTGCAAGTGCATGATCGACCAGGCACATC
AAGAAGAACGGCCAATCCGACAGATTTTGTACCTCGGGGACCTGCTGGAGACCTGCCATTTCCAGGCCTT
CTGGCAAGCCCTGGATGAAAACATGGACCTCTTGGAAGGTATAACTGGCTTTGAAGACTCTGTCCGAAAG
TACAGCCAGCTAAAGGTGTGGATGAGCAAATACGGCTGGAGTGCCGACGAGTCGGGGCAGATCTTCATCT
GTAGCCAAGAAGAGAGCATTAAACCCAAGAACATTGTGGAGAAGATTGACTTTGACAGTGTGTCCAGCAT
CATGGCCTCCTCCCAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001300992
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001300992.1, NP_001287921.1
RefSeq Size 820 bp
RefSeq ORF 579 bp
Locus ID 27335
Gene Summary The 700-kD eukaryotic translation initiation factor-3 (eIF3) is the largest eIF and contains at least 12 subunits, including EIF2S12. eIF3 plays an essential role in translation by binding directly to the 40S ribosomal subunit and promoting formation of the 40S preinitiation complex (Mayeur et al., 2003 [PubMed 14519125]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. It encodes isoform 2, which lacks an internal segment and is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...