RNA terminal phosphate cyclase like 1 (RCL1) (NM_001286701) Human Untagged Clone
CAT#: SC334292
RCL1 (untagged) - Human RNA terminal phosphate cyclase-like 1 (RCL1), transcript variant 4
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (3)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RNAC; RPCL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286701, the custom clone sequence may differ by one or more nucleotides
ATGACATCCTTAACTCCAGGCTGCAGGTACTCTGTACGTGTGTCACCTCAGATGGCGAACCGGATTGTGG ATTCTGCAAGGAGCATCCTCAACAAGTTCATACCTGATATCTATATTTACACAGATCACATGAAAGGAGT CAACTCTGGGAAGTCTCCGGGCTTTGGGTTGTCACTGGTTGCTGAGACCACCAGTGGCACCTTCCTCAGT GCTGAACTGGCCTCCAACCCCCAGGGCCAGGGAGCAGCAGTACTTCCAGAGGACCTTGGCAGGAACTGTG CCCGGCTGCTGCTGGAGGAAATCTACAGGGGTGGATGCGTAGACTCGACCAACCAAAGCCTGGCGCTACT ACTCATGACCCTTGGACAGCAGGATGTTTCCAAAGTCCTGCTAGGCCCTCTCTCTCCCTACACGATAGAA TTTTTGCGGCATTTGAAGAGCTTTTTCCAGATTATGTTTAAAATTGAAACCAAGCCATGTGGTGAAGAAC TCAAGGGTGGGGATAAAGTGCTGATGACCTGTGTTGGCATTGGTTTCTCCAACCTTAGCAAGACCCTCAA GTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286701 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286701.1, NP_001273630.1 |
RefSeq Size | 1477 bp |
RefSeq ORF | 564 bp |
Locus ID | 10171 |
UniProt ID | Q9Y2P8 |
Gene Summary | Does not have cyclase activity. Plays a role in 40S-ribosomal-subunit biogenesis in the early pre-rRNA processing steps at sites A0, A1 and A2 that are required for proper maturation of the 18S RNA (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) lacks five exons in the 5' region but includes an alternate 5' terminal exon, and it thus differs in its 5' UTR and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (c) has a distinct N-terminus and is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它RNA terminal phosphate cyclase like 1产品
Customer
Reviews
Loading...